Skip to main content

Table 2 Primers used for PCR

From: Cloning of a novel thermostable glucoamylase from thermophilic fungus Rhizomucor pusillus and high-level co-expression with α-amylase in Pichia pastoris

Primers Function Sequence (5’-3’)
R.pGJf Primers for conserved regions of glucoamylase gene TGGGGHMGHCCNCARAATGAYGG
R.pGJr RTCGTCAGGRTANCKRCCRATDGC
5-1SP1 Primers for 5’-flanking region of glucoamylase gene TCTTCCCTAGAATTGATGCGTGTGA
5-1SP2 AGTCTAAATCCTTGAATATCGCCGG
5-1SP3 AAGGATAAAGGTCGATGCACGCAGT
5-2SP1 Primers for 5’-flanking region of glucoamylase gene ATCCTCCTCCTCCCATGAAGAAACA
5-2SP2 AGCAATATGTTGGTTGCGGTTGATC
5-2SP3 GAAAAGCATCAGCAGCACCTGAATC
3-1SP1 Primers for 3’-flanking region of glucoamylase gene TGGATGTTTCTATCCTATTGGCAGC
3-2SP2 CCACATAAATATGGATCCATTGCCG
3-3SP3 TTGTATCCACTCAATCGGGAGCAGC
R.pGWr Primers for glucoamylase gene glu’ GATGAAAGCAGCGTACGACCATGTC
R.pGWf TGTGCAAGAATCTACCCTTTTCGAG
R.pGf1 Primers containing putative start codon for cDNA of glucoamylase gene ATGCGTTATGCAACCCCGC
R.pGf2 ATGCTCTTCGCTTTTTGCTATTGT
R.pGf3 ATGTCTTACCGGAAGCAATTTCT
R.pGf4 ATGGGAGGAGGAGGATCTTGGT
R.pGr1 Primers containing putative stop codon for cDNA of glucoamylase gene GGCGTTATTTATTACCCTCTTTTGACC
R.pGf Primers for cDNA of glucoamylase gene ATGGACACGCGATTCAGCCC
R.pGr AGCGTACGACCATGTCAGGTCG
R.pGEcoRf Primers containing restriction enzyme sites for cDNA of glucoamylase gene GGAATTCATGCGTTATGCAACCCCGC
R.pGNotr TTGCGGCCGCTTACCCTCTTTTGACCA
R.pAf Primers for cDNA of α-amylase gene ATGAAATTCAGCATCTCTCTCTCGG
R.pAr TTAAGCAGAGGTGAAGATAGCGGA
R.pAEf Primers containing restriction enzyme sites for cDNA of α-amylase gene GAATTCAGCCCTTTGCCCCAACAGCA
R.pANr TTGCGGCCGCTTAAGCAGAGGTGAAGATAG
  1. The primers are denoted as follows: the start codon and stop codon are underlined; the cons`ervative codons are boxed; the dotted line indicated restriction enzyme sites.