Skip to main content

Table 1 Primers and probes used in this study

From: Mesenchymal stem cell spheroids exhibit enhanced in-vitro and in-vivo osteoregenerative potential

Gene Forward and reverse primers (5′ → 3′) Probe no.
G3PDH AATGTATCCGTTGTGGATCTGA 80
GCTTCACCACCTTCTTGATGT
RUNX-2 GGCCCTGGTGTTTAAATGG 83
AGCACTCACTGACTCGGTTG
OSX CCCAACTGTCAGGAGCTAGAG 26
GATGTGGCGGCTGTGAAT
OPN GGCTACAGCATCTGAGTGTTTG 82
CGGTGAAAGTGGCTGAGTTT
BSP TCGGAAGAAAATGGAGATGG 63
TTCCTCTTCATTTGAAGTCTCCTC
ALP ACGAGGTCACGTCCATCCT 89
CCGAGTGGTGGTCACGAT
  1. G3PDH, glyceraldehyde 3-phosphate dehydrogenase; RUNX-2, runt-related transcription factor-2; OSX, osterix; OPN, osteopontin; BSP, bone sialoprotein; ALP, alkaline phosphatase.