Skip to main content

Table 3 Primers used in this study

From: A new acidophilic thermostable endo-1,4-β-mannanase from Penicillium oxalicum GZ-2: cloning, characterization and functional expression in Pichia pastoris

Primer name Primer purpose Primer sequence Size (bases)
manA-df Degenerate primers CGGGTCTGGGGCTTYAAYGAYGT 23
manA-dr   GTG CCGTAGTAGATGGTRTTNCCRTCRT 28
manA-3-sp3 Amplify gene of the 3’-end by SEFA-PCR ACTTTCCATCTGTACNNNNNNNNNTGTGAG 30
manA-3-sp2 TGACGACCGAGTCTGACGGAAGCTA 25
manA-3-sp1 CTGGGTCAAGGCGACTAGCCAATAT 25
manA-5-sp3 Amplify gene of the 5’-end by SEFA-PCR GTGTTGATGGTGGCGNNNNNNNNNGCAAGA 30
manA-5-sp2 GGAGATGAGATGTACCGCGAAACCA 25
manA-5-sp1 CCATGTGCTTCGGGTCGAGTGATTT 25
manA-f cDNA cloning primers ATGACATTGGGATTGACTCAGACGA 25
manA-r   TCAGATCGCAGCGACATGATT 21
manA-ef Specific expression primers CGGAATTCCAGGTGGCGGAATATGGCCAGTGT 32
manA-er   GCTCTAGATAGATCGCAGCGACATGATTCGTCACCA 36
5’AOX Confirmed primers GACTGGTTCCAATTGACAAGC 21
3’AOX   GCAAATGGCATTCTGACATCC 21
  1. R = A/G, W = A/T, Y = C/T, N = A/T/C/G.