Skip to main content

Table 7 qPCR primers used in this study.

From: A rapid and inexpensive labeling method for microarray gene expression analysis

ORF ID Gene Name Forward Reverse
YBL005W PDR3 GCTTCTGCCTCAGCAGCAAACTCA GGCTAGGCGCAGAATGTTGTCTTTT
YDR011W SNQ2 CACAACCTGTCTCATTGATGCCTGG TGAGCCGTTTGGTGGGTTGAAGT
YDL020C RPN4 CAGTATCAGCATCAAACTGCCAGCC CTGGAATCACTTGGTGAGGATGGTG
YFR003C YPI1 ATGATGATGGATCCTCTTCTTCCGG GTTGGATTTCATAAGCATTGGGGCT
YGR035C - CACCAGCCAAGACTACAAGAACGGA TGATGGGAACTTTGTCTGCATGTGA
YGR052W FMP48 ATCTGATGTTCGGCGATTGCCTT TGCTGCAGGCTAACGTGTAGGTCTT
YGR236C SPG1 ATATTATGTTAGGGCTGGTGGGCGC GCCTTAGTTGTGTCTACGCCGTTGA
YJL219W HXT9 AAGTTGTGGCCTCAAGGAAGCAGTC TTGCCATTCCTCTTGATTTGACCCT
YLR346C - TTGCAGAGTGGGTAGCATGTCCATG TCCTGGGCAGCCTTGAGTAAATCAT
YOL156W HXT11 ATGCTGCTTTGCTGTGTTTGCCTC TAACGTAACAGCCGCCTGCCCA
YNL072W RNH201 GGACCACCAGCGTCCTATCAGAAGA TCATCGGGATCCCTCTTCAAGGA
YLR185W RPL37a CCTGTTCCTCCTGTGGTTATCCAGC AAGCAGAGCCGGTTTGGAAACC
\