Skip to main content

Table 3 Primer sequences

From: Authentication scheme for routine verification of genetically similar laboratory colonies: a trial with Anopheles gambiae

Molecular Assay Primers
An. gambiae species ID/rDNA PCR (5' to 3') Fragment size (bp)
IMP-UN* GCTGCGAGTTGTAGAGATGCG F  
QD-3T* GCATGTCCACCAACGTAAAtCC R An. quadriannulatus 637
ME-3T* CAACCCACTCCCTTGACGaTG R An. melas and merus 529
GA-3T* GCTTACTGGTTTGGTCGGCAtGT R An. gambiae 464
AR-3T* GTGTTAAGTGTCCTTCTCCgTC R An. arabiensis 388
IMP-M1 TAGCCAGCTCTTGTCCACTAGTtTT R Mopti 333
IMP-S1 CCAGACCAAGATGGTTCGcTG R Savanna 221
An. gambiae white gene PCR
UFOR ATTATCTGATGAAGCTTGGAGTCTTTT F  
UREV ATGAAAATAAGGAGCTTCCTGGCAT R positive control 478
MOPR CTGTTGTCTTACAGTAGGGTTAtGT R An. gambiae MOPTI 413
MOP2R AACGTACGACGTATGATCTAACtGA R An. gambiae MOPTI/ZAN/U 350
MALR CTCATATTCAAGGATGAACACAAtAC R An. gambiae MALI 292
PIMPR TCAATGACATGACGTTATAATCTGTCtTT R An. gambiae PIMPERENA 116
  1. Primers indicated with (*) obtained from Wilkins et al [17]. F and R indicate forward and reverse orientation. Lower case indicates site of intentional mismatch. Bold nucleotides show the site of the SNP.