Skip to main content

Table 1 Genes analyzed in RT-PCR experiments, primer sequences and annealing temperature.

From: Isolation of osteogenic progenitors from human amniotic fluid using a single step culture protocol

Gene Gene symbol Primer Sequences Annealing temperature Size (bp)
Stromal cell-derived factor-1 SDF1 F – gacccgcgctcgtccgcc
R – cgggtcaatgcacacacttgtcta
57° 262
Chemokine (C-X-C motif) receptor 4 CXCR4 F – agctgttggctgaaaaggtgg
R – gcgcttctggtggcccttgga
60° 260
Octamer-binding transcription factor 4 Oct-4 F – cgt gaa gct gga gaa gga gaa gct g
R – caa ggg ccg cag ctc aca cat gtt c
60° 245
Stem cell factor SCF F – cca ttg atg cct tca agg ac
R – ctt cca gta taa ggc tcc aa
62° 275
GATA binding protein 4 GATA-4 F – ttc ctc ttc cct cct caa at
R – tca gcg tgt aaa ggc atc tg
60° 194
Vimentin Vim F – tca gcg tgt aaa ggc atc tg
R – cct tcg tga ata cca cg acct gc
56° 321
Fibroblast growth factor 5 FGF-5 F – gct gtg tct cag ggg att gta gga ata
R – tat cca aag cga aac ttg agt ctg ta
62° 434
Paired box 6 Pax-6 F – aga ttc aga tga ggc tca aa
R – aat tgg ttg gta gac act gg
60° 313
Neural cell adhesion molecule NCAM F – gag ggg gaa gat gcc gtg atg tg
R – ata ttc tgc ctg gcc cgg atg gta g
63° 269
Bone morphogenetic protein 2 BMP-2 F – ttg cgg ctg ctc agc atg tt
R – ttg cga gaa cag atg caa gat g
62° 315
Alpha-fetoprotein AFP F – gtg ctg cac ttc ttc ata tgc
R – tga cag cct caa gtt gtt cc
60° 218
Type I collagen COL1 F – ttcctttgcattcatctctca
R – caagtggaccaagcttcctt
58° 149
Osteonectin ONC F – gtctcactggctgtgttgga
R – aagacttgccatgtgggttc
60° 215
Osteopontin OPN F – aggaggaggcagagcaca
R – ctggtatggcacaggtgatg
60° 152
Osteocalcin OCN F – catgagagccctcaca
R – agagcgacaccctagac
58° 315
Osteoprotegerin OPG F – tgctgttcctacaaagttttacg
R – ctttgagtgctttagtgcgtg
60° 433
Bone sialoprotein BSP F – ctatggaaggacgccacgcct
R – catagccatcgtagccttgtcc
62° 578
Runt-related transcription factor 2 Runx2 F – gacagaagcttgatgactctaaacc
R – tctgtaatctgactctgtccttgt
60° 169
Glyceraldehyde-3-phosphate dehydrogenase GAPDH F – ccatggagaaggctggg
R – caaagttgtcatggatgacc
60° 194