Skip to main content

Table 1 Primers and conditions used in RT-PCR analysis

From: Novel immortalized human fetal liver cell line, cBAL111, has the potential to differentiate into functional hepatocytes

Gene Sense primer 5' → 3' Antisense primer 5' → 3' Application Size amplicon (bp) PCR conditions
      Dilution template Annealing temp. (°C)
18S rRNA NA CGAACCTCCGACTTTCGTTT RT   NA  
AAT NA GGGGGATAGACATGGGTATGG RT   NA  
AFP NA CGTTTTGTCTTCTCTTCCCC RT   NA  
Albumin NA ACTTCCAGAGCTGAAAAGCATGGTC RT   NA  
GSTπ NA AGCAGGTCCAGCAGGTTG RT   NA  
HNF4α NA CACTCCAACCCCGCCCCTC RT   NA  
hTERT NA CAGAGCAGCGTGGAGAGGATG RT   NA  
Transferrin NA CCAGACCACACTTGCCCGCTATG RT   NA  
18S rRNA TTCGGAACTGAGGCCATGAT CGAACCTCCGACTTTCGTTT PCR 151 1000× 68 → 63
AAT ACAGAAGGTCTGCCAGCTTC GATGGTCAGCACAGCCTTAT PCR 181 - 68 → 63
AFP TKCCAACAGGAGGCYATGC CCCAAAGCAKCACGAGTTTT PCR 306 - 62 → 55
Albumin TGAGCAGCTTGGAGAGTACA GTTCAGGACCACGGATAGAT PCR 189 - 68 → 63
GSTπ GCCAGAGCTGGAAGGAGG TTCTGGGACAGCAGGGTC PCR 333 10× 70 → 63
HNF4α CCGGGTGTCCATACGCATCCT CAGGTTGTCAATCTTGGCC PCR 321 - 68 → 63
hTERT CGTACTGCGTGCGTCGGTAT GGTGGCACATGAAGCGTAGG PCR 233 - 68 → 63
Transferrin GAAGGACCTGCTGTTTAAGG CTCCATCCAAGCTCATGGC PCR 310 - 68 → 63
  1. Sequences of the primers used in Reverse Transcriptase (RT) reaction or during real-time PCR reaction (PCR) and the conditions used in the real-time PCR reactions. NA = not applicable.