Skip to main content

Table 1 Primers used in this study.

From: Detection of genetically modified organisms (GMOs) using isothermal amplification of target DNA sequences

Primer name Sequence (5'-3')
MS8 LampF (F1c-F2) TGCAAAGGTCGAATCATATTCG-TTTT-GCTGTGGCCCATAAC
MS8 LoopF (LoopFc) GAATATGATCAAAGCGTCC
MS8 DisplF (F3) CTCGAAGGACAAATTTTAAA
MS8-RF3 LampR (B1-B2c) CGATAAGAAAAGGCAATTTGTAGATG-TTTT-GCTTGGACTATAATACCTGACT
MS8-RF3 LoopR (LoopB) CCCATCTTGAAAGAAATATAGT
MS8-RF3 DisplR (B3c) TTCTGAATTTAAACTTGCATC
RF3 LampF (F1c-F2) GGCATTTACCTAGGGGTC-TTTT-ATGTTAACTACCATGCAAAAGTA
RF3 LoopF (LoopFc) GTACAAATTTCAGGGTTTCT
RF3 DisplF (F3) CTACTTTAACCAGAAGTCC
T-nos LampF (F1c-F2) AGATGGTTTTTATGATTAG-TTTT-ATTTATCCTAGTTTGCGC
T-nos LoopF (LoopFc CAATTATACATTTAATACGCG
T-nos DisplF (F3) CATAGATGACACCGCG
T-nos LampR (B1-B2c) TAATTCAACAGAATTATATG-TTTT-AAGTTTCTTAAGATTGAATCCTG
T-nos LoopR (LoopB) TGCAAGACCGGC
T-nos DisplR (B3c) GATCGTTCAAACATTTGG
CaMV35P LampF (F1c-F2) GTCTTCAAAGCAAGTGG-TTTT-GGATAGTGGGATTGTGCG
CaMV35P LoopF (LoopFc) TCCACTGACGTAAGGG
CaMV35P DisplF (F3) AGGAAGGGTCTTGCG
CaMV35P LampR (B1-B2c) TTCCACGAT GCTCCTCG-TTTT-CCTCTGCCGACAGTGG
CaMV35P LoopR (LoopB) GGGGTCCATCTTTGGG
CaMV35P DisplR (B3c) ATAAAGGAAAGGCCATCG
P-nos LampF (F1c-F2) TGCGCGTTCAAAAGTCG-TTTT-ATTTATGGAACGTCAGTGG
P-nos LoopF (LoopFc) AGCTAGCAAATATTTCTTG
P-nos DisplF (F3) TAATTGGATACCGAGG
P-nos LampR (B1-B2c) TGACGTATG TGCTTAGCTC-TTTT-AACCGCAACGTTGAAG
P-nos LoopR (LoopB) TAAACTCCAGAAACCC
P-nos DisplR (B3c) ACAAGCCGTTTTACG
  1. Primer names and sequences used are listed. Nomenclature used by Nagamine et al. (2002) is shown in parentheses.