Skip to main content

Table 1 Primers for the Construction of Human scFv Phage Display Library

From: A compact phage display human scFv library for selection of antibodies to a wide variety of antigens

Primer Sequence
VH5'Sfi 5' CCTTTCTATGCGGCCCAGCCGGCC ATGGCCCAGGTGCAGCTGGTGCAGTCTGG 3'
5' CCTTTCTATGCGGCCCAGCCGGCC ATGGCCGAGGTACAGCTGCAGCAGTCAGG 3'
5' CCTTTCTATGCGGCCCAGCCGGCC ATGGCCCAGGTCAACTTAAGGGAGTCTGG 3'
5' GCCCAGCCGGCC ATGGCCGAGGTGCAGCTGGTGGAGTCTGG 3'
5' GCCCAGCCGGCC ATGGCCCAGGTGCAGCTGCAGGAGTCGGG 3'
5' GCCCAGCCGGCC ATGGCCGAGGTGCAGCTGTTGCAGTCTGC 3'
VH3'link 5' ACCAGAGCCGCCGCCGCCGCTACCACCACCACC TGAGGAGACGGTGACCAGGGTGCC 3'
5' ACCAGAGCCGCCGCCGCCGCTACCACCACCACC TGAGGAGACGGTGACCGTGGTCCC 3'
5' ACCAGAGCCGCCGCCGCCGCTACCACCACCACC TGAAGAGACGGTGACCATTGTCCC 3'
5' ACCAGAGCCGCCGCCGCCGCTACCACCACCACC TGAGGAGACGGTGACCAGGGTTCC 3'
VL5'link-κ 5' AGCGGCGGCGGCGGCTCTGGTGGTGGTGGATCC GACATCCAGATGACCCAGTCTCC 3'
5' AGCGGCGGCGGCGGCTCTGGTGGTGGTGGATCC GAAATTGTGCTGACTCAGTCTCC 3'
5' AGCGGCGGCGGCGGCTCTGGTGGTGGTGGATCC GATGTTGTGATGACTCAGTCTCC 3'
5' AGCGGCGGCGGCGGCTCTGGTGGTGGTGGATCC GAAATTGTGTTGACGCAGTCTCC 3'
5' AGCGGCGGCGGCGGCTCTGGTGGTGGTGGATCC GACATCGTGATGACCCAGTCTCC 3'
5' AGCGGCGGCGGCGGCTCTGGTGGTGGTGGATCC GAAACGACACTCACGCAGTCTCC 3'
VL5'link-λ 5' AGCGGCGGCGGCGGCTCTGGTGGTGGTGGATCC AATTTTATGCTGACTCAGCCCCA 3'
5' AGCGGCGGCGGCGGCTCTGGTGGTGGTGGATCC CAGTCTGTGTTGACGCAGCCGCC 3'
5' AGCGGCGGCGGCGGCTCTGGTGGTGGTGGATCC CAGTCTGCCCTGACTCAGCCTGC 3'
5' AGCGGCGGCGGCGGCTCTGGTGGTGGTGGATCC TCCTATGTGCTGACTCAGCCACC 3'
5' AGCGGCGGCGGCGGCTCTGGTGGTGGTGGATCC TCTTCTGAGCTGACTCAGGACCC 3'
5' AGCGGCGGCGGCGGCTCTGGTGGTGGTGGATCC CACGTTATACTGACTCAACCGCC 3'
5' AGCGGCGGCGGCGGCTCTGGTGGTGGTGGATCC CAGGCTGTGCTCACTCAGCCGTC 3'
VL3'NotI-κ 5' CAGTCATTCTCGACTTGCGGCCGC ACGTTTGATTTCCAGCTTGGTCCC 3'
5' CAGTCATTCTCGACTTGCGGCCGC ACGTTTAATCTCCAGTCGTGTCCC 3'
5' CAGTCATTCTCGACTTGCGGCCGC ACGTTTGATCTCCAGCTTGGTCCC 3'
5' CTCGACTTGCGGCCGC ACGTTTGATATCCACTTTGGTCCC 3'
5' CTCGACTTGCGGCCGC ACGTTTGATCTCCACCTTGGTCCC 3'
VL3'NotI-λ 5' CAGTCATTCTCGACTTGCGGCCGC ACCTAAAACGGTGAGCTGGGTCCC 3'
5' CTCGACTTGCGGCCGC ACCTAGGACGGTGACCTTGGTCCC 3'
5' CTCGACTTGCGGCCGC ACCTAGGACGGTCAGCTTGGTCCC 3'
PTfw 5' CCTTTCTATGCGGCCCAGCCGGCCATGGCC 3'
PTrv 5' CAGTCATTCTCGACTTGCGGCCGCACG 3'
  1. *Bold fonts indicate sequence complementary to the V-gene segments. Recognition sites for restriction enzymes (SfiI/NotI), and linker sequence are italicised.