Skip to main content

Table 1 Summary of conditions and primers used for RT-PCR.

From: Unrestricted somatic stem cells from human umbilical cord blood grow in serum-free medium as spheres

Genes Primer Sequences (5'-3') Cycles Size (bp) Annealing Temperature (°C)
Pluripotency-associated markers
Oct4 F TCTCGCCCCCTCCAGGT 30 218 53
  R GCCCCACTCCAACCTGG    
Sox2 F GGCAGCTACAGCATGATGCAGGACC 34 130 60
  R CTGGTCATGGAGTTGTACTGCAGG    
Endodermal-associated markers
FoxA2 F GGGAGCGGTGAAGATGGA 38 89 55
  R TCATGTTGCTCACGGAGGAGTA    
Gata6 F GAGTGAGAGAAGATGGAAGGG 38 250 55
  R CGCACATGAAATCTGGATGTGG    
Ectodermal-associated markers
Nestin F CAGCTGGCGCACCTCAAGATG 30 209 55
  R AGGGAAGTTGGGCTCAGGACTGG    
Pax6 F AACAGACACAGCCCTCACAAACA 30 275 55
  R CGGGAACTTGAACTGGAACTGAC    
Mesodermal-associated markers
Brachyury F GAACCAGCACCCTGTGTCCAC 38 608 57
  R GCCACGACAAAAAGTCACTGC    
Goosecoid F CTCAACCAGCTGCACTGTC 38 322 55
  R GTCAGCTGTCCGAGTCCAAATC    
Control-associated markers
GAPDH F ATGGAGAAGGCTGGGGCTC 28 196 55
  R AAGTTGTCATGGATGACCTTG