Skip to main content

Table 2 PCR primers used for plasmid construction

From: Large-scale preparation of active caspase-3 in E. coli by designing its thrombin-activatable precursors

Primer 5' → 3'
P1 GGGAATTCCATATGGAGAACACTGAAAACTCAG
P2 CCGCTCGAGGTGATAAAAATAGAGTTCTTTTGT
P3 GGGAATTCCATATGTCTGGAATATCCCTGGACAACAGT
P4 ATCAACGCTGCCGCGCGGCACCAGGCCACAGTCCAGTTCTGTACCACG
P5 TGTGGCCTGGTGCCGCGCGGCAGCGTTGATGATGACATGGCGTGTCAT
P6 ACTGTTGTCCAGGGATATGCTGCCGCGCGGCACCAGGCTTCCATGTATGATCTT
P7 GACTGTGGCATTGAGACAGCGAGTGGTGTTGATGAT
P8 CAGATCATCAACACCACTCGCTGTCTCAATGCCACA
P9 ACAGACAGTGGTGTTGATGATCTGGTGCCGCGCGGCAGCGACATGGCGTGTCATAAA
P10 ACAGACAGTGGTGTTGATGATCTGGTGCCGCGCGGCAGCGACATGGCGTGTCATAAA
  1. * NdeI restriction sites in P1 and P3, and XhoI site in P2 are underlined. Thrombin recognition sites in P4, P5, P6, P9 and P10 and Ala mutations in P7 and P8 are italicized.