Skip to main content

Table 2 Oligonucleotides for the synthesis of paz

From: PCR-based gene synthesis to produce recombinant proteins for crystallization

f4 TTTGTTTAACTTTAAGAAGGAGATATACATATGAGCCACCAGATCCGTTCTAAGAAAACCCTGTGGGAAC
f3 CTAAGAAAACCCTGTGGGAACTCGTTGGTCGTAATAAAGACGCGCTGCGTGATTTCCTGAAAGAACACCGTGGCA
f2 TGAAAGAACACCGTGGCACCATCCTGCTCCGTGACATCGCGTCTGAACACAAAGTTGTTTACAAACCGATCTTCA
f1 GTTGTTTACAAACCGATCTTCAAACGCTACAACGGTGACCCGGACCTGATCGAAGACAACTCTAACGACGTTGAA
r1 TTTTTTCAGTTCCGGGGTGTTCCAGTAACGTTCCAGGTGGTAGTCGTACCAGTGTTCAACGTCGTTAGAGTTGTC
r2 TTCGCCAGGATGATTGGTTGGTTCAGGTCAACCGGACCGAACTTTTTGTAGAACTCTTTTTTCAGTTCCGGGGTG
r3 ACAACGAACTGCGGCAGGAGGTGAACCAGGTCACCACGGTTGTGCTGACGCAGTGGTTTCGCCAGGATGATTGGT
r4 CTTCCTTTCGGGCTTTGTTAGCAGCCGGATCCTTAGTTATAAACCGGAACAACGAACTGCGGCA