Skip to main content

Table 1 Oligonucleotides for the synthesis of polA

From: PCR-based gene synthesis to produce recombinant proteins for crystallization

f22 TTTGTTTAACTTTAAGAAGGAGATATACATATGCTCCGCAAGG
f21 ATATACATATGCTCCGCAAGGTCGAGGTACAAACCGTAGAGCCGGAGGACCGTGAAAGCT
f20 GGAGGACCGTGAAAGCTGGAACGACTTCCTGGAAAATCCACTCCTCAGCCTGTGGCTCGA
f19 TCAGCCTGTGGCTCGAGATGGACGGCGAAAACTATCATCGCGCAGAAATCATCGGTCTCG
f18 GCAGAAATCATCGGTCTCGCACTGTCTGATGGTGAGACCCATCTGTACGTCCCTTGGCGC
f17 GTACGTCCCTTGGCGCACTGCGCGTGACTGGGAGAACCTCCACCGTCTGCTCGCGGACGA
f16 TCTGCTCGCGGACGAGGAACGCAAGAAGATTGTTTATGATGGTAAACGTCTGCAAGTGGT
f15 GTAAACGTCTGCAAGTGGTGCTGAAGCGTCGTGGTCTGGAGGCTGGCGGTCTGGCTTTCG
f14 GGCGGTCTGGCTTTCGACGCGCTCCTGGCTTCTTATCTGCTGGACCCGTCCGAATCTGGC
f13 CCCGTCCGAATCTGGCCACTCTCTGTCCGACCTGGTACAGCGTAAGATGGATGGCTCTCT
f12 CGTAAGATGGATGGCTCTCTCCCACCTGATGAGGAGGTTTACGGTAAAGGTGCCAAACGC
f11 GGTAAAGGTGCCAAACGCCGCCTGCCAGGTGAGCGCGAACTCGCTGAACATCTCGCGCGT
f10 CTGAACATCTCGCGCGTAAAGCGGAAGCGCTCAAGCGCCTCTACCCACTGCTGAGCGAGG
f9 CCACTGCTGAGCGAGGAGATCCGTGAGGCCGGTATGGAGAGCCTGCTCTTTGAAATGGAA
f8 GCCTGCTCTTTGAAATGGAACTGCCACTGAGCCGTGTTCTGGCAGAGATGGAGCTGCATG
f7 CAGAGATGGAGCTGCATGGCGTACGTGTCGACCGCGACCGTCTCCTGGACCTGGGTGAAG
f6 CCTGGACCTGGGTGAAGAACTCAAGGAACAGGCAGAATCCCTCACGCGTCAAATCTACGA
f5 TCACGCGTCAAATCTACGAACTGGCGGGTACCGAATTCAACATTAACTCTCCGAAACAGC
f4 ACATTAACTCTCCGAAACAGCTCGCCGAGATTCTCTACGACAAACTGGGTCTGCCGGTTC
f3 CTGGGTCTGCCGGTTCTCAAAAAGACTAAAACGGGCTATTCTACCTCTGCGGACGTTCTG
f2 CCTCTGCGGACGTTCTGGAGAAACTGGCACCGCAACATGAAATCGTTGAAAAAATCCTGC
f1 GAAATCGTTGAAAAAATCCTGCACTACCGCCAAATCATGAAACTGATCTCCACCTATGTC
r1 TTTACCGGATTCCGGGTCGATTTCCTTCAGGAGGCCCTCGACATAGGTGGAGATCAGTTT
r2 GCGGCCAGTTGCAGTGATAGTCTGGTTGAAACGCGTGTGAATTTTACCGGATTCCGGGTC
r3 CAGGCGAATCGGGATATTTTGCAGGTTCGGCTCGGTAGAGCTGAGGCGGCCAGTTGCAGT
r4 CAGACGGAACGAATACCTGACGGATGCGACGACCTTCCTCCAGGCGAATCGGGATATTTT
r5 AATCTGAGAGTAATCTGCGCTCAGGATCTGCCAACCCGGTTCAGACGGAACGAATACCTG
r6 GAGACTCGTCGCCAGACAGATGAGCCAGTACGCGGAGCTCAATCTGAGAGTAATCTGCGC
r7 GTCTTAGTATGAATGTCCATGTCTTCGCTAAAAGCCTGTTTGAGAGACTCGTCGCCAGAC
r8 AACTTCATCTTCAGGGACACCGAACACATCCATAGCGGTCTTAGTATGAATGTCCATGTC
r9 CGAAATTAACCGCCTTTGCTTGACGACGCATGAGAGAGGTAACTTCATCTTCAGGGACAC
r10 GTTTTGGGACAGGCCGTAATCAGAAATGCCGTAGATGATACCGAAATTAACCGCCTTTGC
r11 AACGTTCAATGAATTGCGCCGCTACTTTACGTGGGATGTTGAGGTTTTGGGACAGGCCGT
r12 ACGATCCATGTATTCTTTAACACCAGGGTAAGATTGGAAGTAACGTTCAATGAATTGCGC
r13 TGGTAACGTAACCGTCTTTACGGGCTTGCTCTACAACACGATCCATGTATTCTTTAACAC
r14 AGCGAATTTCCGGGAGGTAGCGACGGCGGTTGAGCATGGTGGTAACGTAACCGTCTTTAC
r15 ATCGCCGTACGTTCCGCGAAAGTGCGGCGATTGTAGTTACGAGAGCGAATTTCCGGGAGG
r16 CGGTTTTGATAATATCTGCCGCAGAACCCTGGATCGGGGTGTTCATCGCCGTACGTTCCG
r17 CGCGGCGACGTTTGATCTCACGATGCAGGCGTACCATGGCGGTTTTGATAATATCTGCCG
r18 CAAAAATGAGTTCGTCGTGAACTTGGAGCAGCATACGAGACTTAACGCGGCGACGTTTGA
r19 CCAGATTTTTCATTTCTTCGAGTTCCTCTTCTGGAACTTCAAAAATGAGTTCGTCGTGAA
r20 ACGGAGAGCGGGACCGCTTGTTCCATAACCGTACGAACCAGATTTTTCATTTCTTCGAGT
r21 GCTTCATACCAAGTCTGACCGGTGTGGATATCAACTTTGAGCGGCACGGAGAGCGGGACC
r22 CTTCCTTTCGGGCTTTGTTAGCAGCCGGATCCTTATTTGGCTTCATACCAAGTCTGACC