Skip to main content

Table 1 List of gene specific primers.

From: RNAi-mediated gene silencing in tick synganglia: A proof of concept study

Target gene Forward primer (5'-3') Reverse primer (5'-3')
Na+-K+-ATPase Alpha subunit (DN968449) ACGAAACTGCCGAGAGCGACATTA ATCCTGAGACCTTTGTCCATGCCT
β-Actin (DN972266) AAACATCCGACATGTGTGACGACGA TGTGGTGCCAGATCTTCTCCATGT
Cyclophilin A (DN970760) AAACATCCGACATGTGTGACGACGA TGCCGAAAGACTCCATCTGCTTGT
Cyclophilin G (DN969372) GCTTCGGTTACAAGGGCAGCATTT TGCCGAAAGACTCCATCTGCTTGT
Calreticulin (DN 970315) TCTTTGCAACGTGGTTTCCTGAGC TCAGCAGGTTCTTGCCCTTGTAGT