Skip to main content

Table 1 Primers used in RT-PCR and generated PCR product sizes (in base pairs). During PCR the tag used as antisense primer was CAACAGACGCACGACGCAGCAGAC (bold in the tagged RT primer sequences).

From: Webtag: a new web tool providing tags/anchors for RT-PCR experiments with prokaryotes

Gene Tagged RT primer Sense primer PCR product
hupS CAACAGACGCACGACGCAGCAGACGGTAATTCTTTAGGAACTC CCATGTCACCCAACCCCAGCGAATCAG 533 bp
rnpB CAACAGACGCACGACGCAGCAGACGAAAGAGCAGTACATAAGC AGGGTGCAAAGGTGCGGTAAGAGCG 232 bp
rbcL CAACAGACGCACGACGCAGCAGACGAAACGGATATCTTCTAGAC CGTTCCGCATGACACCCCAGCC 329 bp