Skip to main content

Table 1 Primers used in this study.

From: An integrative expression vector for Actinosynnema pretiosum

Primer Sequence (5' – 3')
Vector construction
   IS117-KpnI TGACTGGTACCGGAGTCGGGGATGTTCTTGTTC*
   IS117-NheI TGACTGCTAGCGTACCGGTGCCCCGATAGAC
   ermE-XbaI/KpnI AAAATCTAGAGGTACCAGCCCGACCCGAGCA
   ermE-BamHI/EcoRV AAAAGATATCGGATCCACCAACCGGCACGA
   xylE-F4Bam CGCGGATCCAGCGATGAACAAAGGTGTAATGCGACC
   xylE-FEBam CGCGGATCCAAGCTAACGTAAGGAGGAAAAACATATGAACAAAGGTGTAATGCGACCGGGCCAT
   xylE-FABam CGAGGATCCTCCCCACAGACAGGGAGCCCAGCATATGAACAAAGGTGTAATGCGACCGGGCCAT
   xylE-REcoRI GCGGAATTCTCAGGTCAGCACGGTC
   rifH-FNdeI CGCATACATATGGTGAAGCGGCAGCCGGACTTCG
   rifH-RASE CGCGAATTCACTAGTCCTAGGCTAGCGCAGCATCTTCGCGATCG
   xylE-FSpeI AATACTAGTATGAACAAAGGTGTAATGCGACCGGGCCAT
   xylE-FRBSSpeI CGCAATACTAGTAAGCTAACGTAAGGAGGAAAAACATATGAACAAAGGTGTAATGCGACCGGGCCAT
qPCR
   rifH-668F AGATCTACGTCAGCCACGAAATG
   rifH-788R TCGCCGATCCACAGGAA
   16S-F CAGAAGAAGCACCGGCTAAC
   16S-R TTAAGCCCCAAGTTTTCACG
Southern hybridization
   IS117-F CTGAACTCACCGCGACGTATCG
   IS117-R GCTAGCGTACCGGTGCCCCG
Plasmid rescue and sequencing
   intseq1 CCGTTTGGCCTCCGACTAAC
   intseq2 GCTCTATCGGGAGGCCTCAC
   attM5'1 GGAGCAGACGCTCGTCCGGG
   siteA-F GTCGTGGTCACCAGGCGGAC
   siteA-R ACCGCCTTCGTCCGTGCCAG
   siteB-F GATCTGTGTTCGCGGAGAGC
   siteB-R ACAAGGGCGTCAGCGAGGAA
   siteC-F GGTGTCCTCGATGCGGAAGA
   siteC-R AAGTCCCCGTGCTTCTCCAG
   siteD-F GACCCCCTCCGCGAACTGGT
   siteD-R GGCCTGCGAGGTTTGTGCGC
  1. *Restriction sites are underlined