Skip to main content

Table 1 Primers. List of oligonucleotides used for vector construction and Fc region cloning.

From: Construction of miniantibodies for the in vivo study of human autoimmune diseases in animal models

Number Name Orientation Sequence
A Hygro-XbaI-inv Antisense AGCTTCTAGACAGCTTGGGTCTCCCTATAG
B Hygro-HindIII-inv Sense AGCTAAGCTTAAACCCGCTGATCAGC
1 1-XbaI-leader Sense CAGGCGTCTAGATGCCACCATGGGCTGGAGCCTGATCCTCCTGTTCCTCGTCGCTGTGGCTACAGGTAAGGG
2 2-leader-intron Sense TGTGGCTACAGGTAAGGGGCTCACAGTAGCAGGCTTGAGGTCTGGACATATATATGGGTGACAATGACATCCAC
3 3-BssHII-scFv Sense GGTGACAATGACATCCACTTTGCCTTTCTCTCCACAGGTGGCGCGCATGCCGACATCCGGTTGACCCAG
4 scFv-NheI-HindIII Antisense CCGCTAAGCTTCGCCTGGCTAGCAAAAGCGTCCGTCGTATC
5 HuGCH2-s Sense AGGCGGCTAGCGACAAAACTCACACATGCCCACCGTGCCCA
6 HuGCH3-SV5-a Antisense CTGCTAAGCTTTTAAGTACTATCCAGGCCCAGCAGTGGGTTTGGGATTGGTTTGCCACTAGTTTTACCCGGGGACAGGGAGAG
7 HuACH2-s Sense CAGGCGGCT AGCGTTCCCTCAACTCCACCTACC
8 HuACH3-a Antisense CCGCTACTAGTTTTACCCGCCAAGCGGTCGAT
9 MoGCH3-a Antisense CCGCTACTAGTTTTACCAGGAGAGTGGGAGAG
10 MoGCH2-s Sense CAGGCG GCT AGC GGTTGTAAGCCTTGCATATGTACA
11 RaGCH3-a Antisense CCGCTACTAGTTTTACCCGGAGGCCGGGAGATG
12 RaGCH2-s Sense CAGGCG GCT AGC CACAAATGCCCTACATGCCCT
\