Skip to main content

Table 3 Structure of cloning sites of siRNA expression vectors

From: Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology

Vector Promoter Sequence of cloning site
piGENE hU6 hU6 CACCGTGAGCAGGTGTAAAGCCACCATGGAAGACACCTGCCAAC TTTTTTCAATTGGTCGACCTGCAGGCATGCAAGCTTa
piGENE CACC-S/K hU6 CACCGAGCTC AGACTC GATATC GGTACCb
piGENE S/K hU6 GAGCTC AGACTC GATATC GGTACC c
piGENE tRNA tRNA GAGCTCCAGATCTAATGCGGCCGCTTAGGTACCATAGATATC TTTTTTT CTGCAGGCATGCAAGCTTd
  1. a: Three Bsp MI sites are underlined. b and c: Sac I, Bgl II, Eco RV, and Kpn I sites are underlined. d: Sac I, Bgl II, Not I, Kpn I, Eco RV, Pst I, and Hind III sites are underlined. T repeats, RNA pol III terminator signal, are italicized.