Skip to main content

Table 2 Target sequences examined

From: Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology

No.

Positiona

sequence

nt

Constructed vectors ()b

Valuec

    

hU6

CACC-S/K

S/K

tRNA

 

1

132–150

GGGCAGTCCTGGAGGCAAC

19

0.779

2

132–153

GGGCAGTCCTGGAGGCAACCGT

22

 

3

372–390

AGGAGCTGCTGCAGCTGGA

19

0.775

4

372–393

AGGAGCTGCTGCAGCTGGAGCA

22

 

5

569–591

GTGTCAATATCACAGTCAAGGA

22

   

0.757

6

616–634

GGGGAGAACTTCACCGAAA

19

0.852

7

616–635

GGGGAGAACTTCACCGAAAC

20

 

8

616–636

GGGGAGAACTTCACCGAAACT

21

 

9

616–637

GGGGAGAACTTCACCGAAACTG

22

 

10

616–634

GGGGAGAACTTCACCGAAACTGA

23

 

11

616–634

GGGGAGAACTTCACCGAAACTGAT

24

    

12

616–634

GGGGAGAACTTCACCGAAACTGACA

25

 

13

616–634

GGGGAGAACTTCACCGAAACTGACATC

27

 

14

616–634

GGGGAGAACTTCACCGAAACTGACATCAA

29

 

15

725–743

GTGTGATCCTCTTCTCTTC

19

0.772

16

725–746

GTGTGATCCTCTTCTCTTCCCC

22

 

17

730–748

ATCCTCTTCTCTTCCCCTC

19

   

0.752

18

730–751

ATCCTCTTCTCTTCCCCTCCTG

22

    
  1. a, Position 1 starts from A of ATG, the first codon of bPRNP. b, hU6, CC-S/K, S/K, and tRNA indicate piGENE hU6, piGENE CACC-S/K, piGENE S/K, and piGENE tRNA, respectively (Table 3). Open circles designate construction of vectors. c, Values were obtained from the prediction algorithm [20].