Skip to main content

Table 2 Target sequences examined

From: Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology

No. Positiona sequence nt Constructed vectors ()b Valuec
     hU6 CACC-S/K S/K tRNA  
1 132–150 GGGCAGTCCTGGAGGCAAC 19 0.779
2 132–153 GGGCAGTCCTGGAGGCAACCGT 22  
3 372–390 AGGAGCTGCTGCAGCTGGA 19 0.775
4 372–393 AGGAGCTGCTGCAGCTGGAGCA 22  
5 569–591 GTGTCAATATCACAGTCAAGGA 22     0.757
6 616–634 GGGGAGAACTTCACCGAAA 19 0.852
7 616–635 GGGGAGAACTTCACCGAAAC 20  
8 616–636 GGGGAGAACTTCACCGAAACT 21  
9 616–637 GGGGAGAACTTCACCGAAACTG 22  
10 616–634 GGGGAGAACTTCACCGAAACTGA 23  
11 616–634 GGGGAGAACTTCACCGAAACTGAT 24     
12 616–634 GGGGAGAACTTCACCGAAACTGACA 25  
13 616–634 GGGGAGAACTTCACCGAAACTGACATC 27  
14 616–634 GGGGAGAACTTCACCGAAACTGACATCAA 29  
15 725–743 GTGTGATCCTCTTCTCTTC 19 0.772
16 725–746 GTGTGATCCTCTTCTCTTCCCC 22  
17 730–748 ATCCTCTTCTCTTCCCCTC 19     0.752
18 730–751 ATCCTCTTCTCTTCCCCTCCTG 22     
  1. a, Position 1 starts from A of ATG, the first codon of bPRNP. b, hU6, CC-S/K, S/K, and tRNA indicate piGENE hU6, piGENE CACC-S/K, piGENE S/K, and piGENE tRNA, respectively (Table 3). Open circles designate construction of vectors. c, Values were obtained from the prediction algorithm [20].