Skip to main content

Table 2 Oligonucleotides used in this study.

From: Translational control of recombinant human acetylcholinesterase accumulation in plants

# Name 5' Sequence 3'
1 TEVf CAACATATACAAAACAAACGAATCTCAAG
2 TEVr GCTATCGTTCGTAAATGGTGAAAA
3 TEVp ATTCTACTTCTATTGCAGCAAT
4 oTM001 GATATCTGCAGCCATGGCTAGGCCCCCGC
5 oTM087 GTCTGCTACCAATATGTGGACACCC
6 oTM109 CTTTGCGGAGCCACCAATGGGACCCCGTCGC
7 oTM110 GCGACGGGGTCCCATTGGTGGCTCCGCAAAG
8 oTM089 CCCACCTTGTGGGCTGTCCTCCAGG
9 oTM090 CCTGGAGGACAGCCCACAAGGTGGG
10 oTM005 GGGTACCCGCCGGGGTCACAGGTCTG
11 oTM049 GAGTGTCTTAGGTGACTTACCCAC
12 oTM125 ATTTCCATGGGAAGGCCTCCACAATGTCTCCTCCACACTCCTTCCTTG
13 oTM127 CTCTTCCACAGGGCTGTGCTCCAATCTGGCGCGCCCAATGG
14 oTM128 GCCCACAGTGGCCCAGGGACCATTGGGCGCGCCAGATT
15 oTM126 TTCAGCAAGGACAATGAGTCTCTCATCTCCAGGGCTGAGTTCTTGGCTG
16 oTM129 CCAGTGGCACAATTGGCTGGAAGATTGGCTGCCCAAGGTGCC
17 oTM130 CTTCCAGCCAATTGTGCCACTGGGCACACCACATTGTGGTCTCCCAC
18 oTM131 TCCACCGCCACCACCGGTACCGAGCTCTCAGAGGTCTGAGCA
19 oTM047 AAGATAGGTGCTCAGACCTCTGAGAGCT
20 oTM085 GATACTCACAGAAAGAGGCTACTC
21 oTM086 CAGGATACGGGGAGCTAATGCAG
22 oTM095 GCCCAATGGACCCTGGGCC
23 oTM096 GGCCCAGGGTCCATTGGGC
24 oTM097 GTTCCCCAAGTaagtGACTTGGCTGC
25 oTM098 GCAGCCAAGTCacttACTTGGGGAAC
26 oTM099 CTGGAGCACAACAgtacGTTTCTTTGGACC
27 oTM100 GGTCCAAAGAAACgtacTGTTGTGCTCCAG
28 oTM101 CCCCCAATGGtCCCTGGGCC
29 oTM102 GGCCCAGGGaCCATTGGGGG
30 oTM103 GGTTCCCCAGGTttcaGACCTGGCAG
31 oTM104 CTGCCAGGTCtgaaACCTGGGGAACC
32 oTM105 GGGGCTCAGCAatatGTTAGTCTGGACC
33 oTM106 GGTCCAGACTAACatatTGCTGAGCCCC
34 oTM165 CCATGGGACCTAGGCGCTTTCTGC
35 oTM166 GCAGAAAGCGCCTAGGTCCCATGG
36 oTM167 CCAATGGGACCTAGGAGGTTTCTCCC
37 oTM168 GGGAGAAACCTCCTAGGTCCCATTGG
38 VSPf GCTAGAGTTTGCTCCTATCTATATGTAATAAGG
39 VSPr CATTAACAAACATAGCTAATGCTCCTATTT
40 VSPp ATGCTGATATGCACTATT