Skip to main content

Table 1 Primers used for PCR analysis

From: Production of transgenic strawberries by temporary immersion bioreactor system and verification by TAIL-PCR

PCR experiment name sequence (5'-3') Reference
Transgene detection hptIIF ACGAGCGGGTTCGGCCCATT this work
  hptIIR CGGCTCCGGATCGGACGATT  
Agrobacterium control virGF GCCGACAGCACCCAGTTCAC [51]
  virGR CCTGCCGTAAGTTTCACCTCACC  
TAIL-PCR, T-DNA specific LB1 TTCCTAAAACCAAAATCCAG this work
  LB2 ATTCGGCGTTAATTCAGTAC  
  LB3 AAAAACGTCCGCAATGTGTT  
TAIL-PCR, arbitrarya AD2 NGTCGASWGANAWGAA [23]
  AD3 WGTGNAGWANCANAGA [23]
  AD6 WGCNAGTNAGWANAAG [52]
  AD7 AWGCANGNCWGANATA [52]
  1. aIUPAC-IUP codes for the wobble bases: W = A or T, N = G or A or T or C