Skip to main content

Table 2 A summary of the oligonucleotides used to generate and sequence confirm the pSANG expression vectors.

From: A simple vector system to improve performance and utilisation of recombinant antibodies

Primer Designation Primer sequence (5'-3')
CysBgSaS 5'-3cggccatggcccaggtgcagctgcaggcggccgcatgcgcacatcatcatcaccatcacaagctttaataag-3'
CysBgSaA 5'-3tcgacttattaaagcttgtgatggtgatgatgatgtgcgcatgcggccgcctgcagctgcacctgggccatggccggct-3'
SerBgSaS 5'-3cggccatggcccaggtgcagctgcaggcggccgcatccgcacatcatcatcaccatcacaagctttaataag-3'
SerBgSaA 5'-3tcgacttattaaagcttgtgatggtgatgatgatgtgcggatgcggccgcctgcagctgcacctgggccatggccggct-3'
Leadless 5'-ctagaaataattttgtttaactttaagaaggagatatacc-3'
leadlesA 5'-catgggtatatctccttcttaaagttaaacaaaattattt-3'
PstMBP 5'-nnnnnnctgcaggcggccgcaaaaatcgaagaaggtaaactggtaatc-3'
MBPCysHind 5'-nnnnnnaagcttgtgatggtgatgatgatgtgcacaagtctgcgcgtctttcagggcttcatcgac-3'
MBPSerHind 5'-nnnnnnaagcttgtgatggtgatgatgatgtgcagaagtctgcgcgtctttcagggcttcatcgac-3'
NcoMBP 5'-gcccagccggccatggcccaggtgcagctgcaggcggccgcaaaaatcgaagaaggtaaactggtaatc-3'
mut AP sense 5'-gcaacgtaccacggcaatatcgat-3'
mut AP antisense 5'-atcgatattgccgtggtacgttgc-3'
pstAlkP 5'-nnnnnnctgcaggcggccgcaaccccggaaatgcctgttctggaaaaccgg-3'
alkPSerHind 5'-nnnnnnaagcttgtgatggtgatgatgatgtgcagacggtactttcagccccagagcggctttcat-3'
H3flagS 5'-3agctggactacaaagaccatgacggtgattataaagatcatgacatcgattacaaggatgacgatgacaagtaataaa-3'
H3flagA 5'-3agcttttattacttgtcatcgtcatccttgtaatcgatgtcatgatctttataatcaccgtcatggtctttgtagtcc-3'
T7promoter2 5'-gatcgagatctcgatcccgcga-3'
T7terminator 5'-gctagttattgctcagcg-3'