Skip to main content

Table 1 Primer List

From: Transformation of Anaplasma phagocytophilum

pET28 T7 replace PCR CCTATAGTGAGTCGTATTAATTTCGCGGGATCG
pET28 lacO PCR phos-GGAATTGTGAGCGGATAACAATTCCCCTC
5' Amtr pro Himar1 GTTGTTAGATCTGGCTCCTCCTAGAACGATCGC
3' Amtr pro Himar1 phos-GATAACTTAGGATAAATCATACATAATGTTAATGCAACAG
5' Am tr pro GTTGTTGAATTCGGCTCCTCCTAGAACGATCGC
3' Am tr pro GTTGTTGGATCCTATCCCTTATGTTACTCAGATAACTTAGGATAAATCA
GFPuv SDM A CCACAACATTGAAGATGGTTCCGTTCAACTAGCAGACC
GFPuv SDM B GGTCTGCTAGTTGAACGGAACCATCTTCAATGTTGTGG
5' GFPuv PCR GTTGTTGGATCCATGAGTAAAGGAGAAGAACTTTTCACTG
3' GFPuv PCR phos phos-AATCCCTATTTGTAGAGCTCATCCATGCCATGTGTAATC
3' S-S Xba PCR GTTGTTTCTAGATTATTTGCCGACTACCTTGGTGATCTCGCCTTTC
5' S-S PCR phos phos-AAATTATGAGGGAAGCGGTGATCGCCGAAGTATCGACTC
Bam re SDM A CTGAGTAACATAAGGGATATTATAATGAGTAAAGGAGAAGAAC
Bam re SDM B GTTCTTCTCCTTTACTCATTATAATATCCCTTATGTTACTCAG
Himar1 right repeatA TGTTGAAGCTTAGACCGGGGACTTATCAGCCAACCTGTTACTCGAGTTGT
Himar1 right repeatB ACAACTCGAGTAACAGGTTGGCTGATAAGTCCCCGGTCTAAGCTTCAACA
Himar1 left repeatA TGTTGAGATCTAACAGGTTGGCTGATAAGTCCCCGGTCTGAATTCTTGTT
Himar1 left repeatB AACAAGAATTCAGACCGGGGACTTATCAGCCAACCTGTTAGATCTCAACA
UV-SS up and out CATCACCTTCACCCTCTCCACTGAC
UV-SS down and out CAGCCCGTCATACTTGAAGCTAGGC
Forward UV-SS confirmation PCR AAAGATGACGGGAACTACAAGACG
Reverse UV-SS confirmation PCR CACAACAATGGTGACTTCTACAGCG