Skip to main content

Table 1 Information on the primers used for real-time PCR

From: Development of a new set of reference genes for normalization of real-time RT-PCR data of porcine backfat and longissimus dorsi muscle, and evaluation with PPARGC1A

Gene Primer sequence (5'→3') Amplicon length Ta GenBank accession number or reference
ACTB TCTGGCACCACACCTTCT
TGATCTGGGTCATCTTCTCAC
114 bp 60°C [GenBank:DQ178122]
B2M AAACGGAAAGCCAAATTACC
ATCCACAGCGTTAGGAGTGA
178 bp 60°C [GenBank:DQ178123]
GAPDH ACTCACTCTTCTACCTTTGATGCT
TGTTGCTGTAGCCAAATTCA
100 bp 57°C [GenBank:DQ178124]
HMBS CTGTTTACCAAGGAGCTGGAAC
TGAAGCCAGGAGGAAGCA
100 bp 59°C [GenBank:DQ178125]
HPRT1 CCGAGGATTTGGAAAAGGT
CTATTTCTGTTCAGTGCTTTGATGT
181 bp 60°C [GenBank:DQ178126]
RPL13A AGTTAAAGTACCTGGCCTTCCT
TGGCCTCTCTTGGTCTTG
136 bp 59°C [GenBank:DQ178127]
SDHA GAACCGAAGATGGCAAGA
CAGGAGATCCAAGGCAAA
191 bp 58°C [GenBank:DQ178128]
TBP GATGGACGTTCGGTTTAGG
AGCAGCACAGTACGAGCAA
124 bp 59°C [GenBank:DQ178129]
TOP2B AACTGGATGATGCTAATGATGCT
TGGAAAAACTCCGTATCTGTCTC
137 bp 60°C [40]
YWHAZ ATGCAACCAACACATCCTATC
GCATTATTAGCGTGCTGTCTT
178 bp 60°C [GenBank:DQ178130]
PPARGC1A CCTGCATGAGTGTGTGCTCT
CTCAGAGTCCTGGTTGCACA
107 bp 59°C [18]