Skip to main content

Table 1 Genomes used for tag generation and testing.

From: Generation of non-genomic oligonucleotide tag sequences for RNA template-specific PCR

Organism Group tag Lanes in Figure 2
Gallus gallus Animals CACTCACAAGCTCGACGTACAC 1 and 8
Canis familiaris Animals CAGACAGCACTCGTTCGTACAC 2 and 9
Arabidopsis thaliana Plants GACTGAACGTGCTCTGCTACTG 3 and 10
Sulfolobus acidocaldarius str. DSM639 Crenarchaeota CAGTCACAGCACACGAGTACAC 4 and 11
Bartonella henselae str. Houston-1 Alphaproteobacteria CAGACACGAGCAACGACTACAC 5 and 12
Bartonella henselae str. UGA 8 Alphaproteobacteria CAGACACGAGCAACGACTACAC 6 and 13
Anabaena PCC7120 Cyanobacteria CACTCTGTGCTCGTTGCTACAC (Figure 3)
Synechocystis PCC 6803 Cyanobacteria CAGACAGCAAGCAGCACTACAC (Figure 3)