Skip to main content

Advertisement

Table 3 Information on the primers used in this study

From: Selection of a set of reliable reference genes for quantitative real-time PCR in normal equine skin and in equine sarcoids

Gene Genbank accession number Primer sequence Ta (°C) Product size (bp) Primer concentration
ACTB AF035774 CCAGCACGATGAAGATCAAG
GTGGACAATGAGGCCAGAAT
59 88 0.5 μl
10 μM
B2M X69083 GTTCCATCCGCCTGGAGATT
GGGGGTCTTTGAGAGTAGAGTG
60 182 0.25 μl
10 μM
HPRT1 AY372182 GGCAAAACAATGCAAACCTT
CAAGGGCATATCCTACGACAA
60 163 0.5 μl
10 μM
UBB AF506969 GCAAGACCATCACCCTGGA
CTAACAGCCACCCCTGAGAC
61 206 0.5 μl
10 μM
TUBA1 AW260995 GCCCTACAACTCCATCCTGA
ATGGCTTCATTGTCCACCA
60 78 0.5 μl
10 μM
RPL32 CX594263 AGCCATCTACTCGGCGTCA
TCCAATGCCTCTGGGTTTC
61 149 0.25 μl
10 μM
GAPDH AF157626 GATGCCCCAATGTTTGTGA
AAGCAGGGATGATGTTCTGG
61 250 0.5 μl
10 μM