Skip to main content

Table 2 Primers used to amplify the portions of S-layer protein gene of Lactobacillus crispatus (lbs), the green fluorescent protein gene (gfp mut2), and the erythromycin gene (ermAM) used as selective marker, respectively.

From: Genetic transformation of novel isolates of chicken Lactobacillusbearing probiotic features for expression of heterologous proteins: a tool to develop live oral vaccines

Primer sequence Amplicon Size (bp)
5'GGATCCCGGTCATTTTAACTTGCTA 3'   
5'CTCGAGGATATCTGCAGCGTTAACAGAAACAGCTG 3' lbs promoter plus leader peptide 344
5'GAATTCATGCACAACGCATTCTTCTATG 3'   
5'AAGCTTCAGAAGATCCTATTAGAACTGTATGTTTAG 3' lbs anchor plus terminator 600
5'CTCGAGGCTAGTAAAGGAGAAGAACTTTTCACT 3'   
5'GAATTCTGCTTTGTATAGTTCATCCATGCCATG 3' gfp mut2 720
5'GGGCCCTCTAGCACAAAAAGAAAAACG 3'   
5'GGATCCTCTAGAGTCTAGGGACCTCTTTAGC 3' erm AM 1200