Skip to main content

Table 1 Primers, stacking oligonucleotides, synthetic targets and capture probes used.

From: Low density DNA microarray for detection of most frequent TP53 missense point mutations

Primers
Name Sequence (5'→3')
PCREX7-F GCTCTGACTGTACCACCATCCA
PCREX7-R ACCTGGAGTCTTCCAGTGTGA
PCREX8-F ACTGGGACGGAACAGCTTTGA
PCREX8-R GCTCCCCTTTCTTGCGGAGAT
Stacking oligonucleotides
Name Sequence (5'→3')
LSO108–248 CCTGCATGGGCGGCATG
RSO108–248 GGCCCATCCTCACCATCATC
LSO108–249 GCATGGGCGGCATGAACCG
RSO108–249 ATCCTCACCATCATCACTC
LSO92–273 GGGACGGAACAGCTTTGAGG
RSO92–273 TTGTGCCTGTCCTGGGAGA
Synthetic targets
Name Sequence (5'→3')
ST-157,158WT GGTGTGGGGGCGGGCCGTGGGCGCAGGCGCGGTACCGGTAGATGTTCGTC
ST-248,249WT GTGTGATGATGGTGAGGATGGGCCTCCGGTTCATGCCGCCCATGCAGG
ST-248C→T GATGATGGTGAGGATGGGCCTCCAGGTCATGCCGCCCATGCAGG
ST-248G1→T GATGATGGTGAGGATGGGCCTCAGGTTCATGCCGCCCATGCAGG
ST-248G1→A GATGATGGTGAGGATGGGCCTCTGGTTCATGCCGCCCATGCAGG
ST-249G1→T TGATGATGGTGAGGATGGGCATCCAGTTCATGCCGCCCATGCAGG
ST-249G2→T TGATGATGGTGAGGATGGGACTCAGGTTCATGCCGCCCATGCAGG
ST-249G2→C TGATGATGGTGAGGATGGGGCTCTGGTTCATGCCGCCCATGCAGG
ST-273WT CTCTCCCAGGACAGGCACAAACACGCACCTCAAAGCTGTTCCGTCCC
ST-273G→T CTCTCCCAGGACAGGCACAAACAAGCACCTCAAAGCTGTTCCGTCCC
ST-273G→A CTCTCCCAGGACAGGCACAAACATGCACCTCAAAGCTGTTCCGTCCC
ST-273C→T CTCTCCCAGGACAGGCACAAACACACACCTCAAAGCTGTTCCGTCCC
Capture probes
Name Sequence (5'→3')
p-157WT CGCGTCC@
p-158WT GTCCGCG@
p-248WT AACCGGA@
p-248C→T AACTGGA@
p-248G1→T AACCTGA@
p-248G1→A AACCAGA@
p-249WT GAGGCCC@
P-249G1→T GATGCCC@
P-249G2→T GAGTCCC@
P-249G2→C GAGCCCC@
P-273WT = TGCGTGT@
P-273-G→T TGCTTGT@
P-273G→A TGCATGT@
P-273C→T TGTGTGT@
  1. @ = 3'-aminopropanol modification for glass attachment.
  2. Base changes are represented in bold