Skip to main content

Table 1 Promoters analysed in this study. The promoters (column 1 and 4) were amplified by PCR using the template DNA (column 2) and the primers (column 3) listed in the table.

From: Viral promoters can initiate expression of toxin genes introduced into Escherichia coli

Promoter fragment Template DNAa Primer sequenceb Size of promoter-fragment
P PH: Polyhedrin promoter from baculovirus pBacPAK8 [29] PH-1: GCCCGGGCCATCTCGCAAATAAATAAG
78 bp
P CMV: Enhancer and immediate early promoter from CMV pRL-CMV [30] CMV-1: GCCCGGGGATCTTCAATATTGGCCATTAGCC
802 bp
P SV40: Early promoter from SV40 pGL3 [31] SV40-1: GCCCGGGCTAGCCCGGGCTCGAGATCTG
223 bp
P TK Thymidine kinase promoter from HSV1 pRL-TK [32] TK-1: GCCCGGGATCTAAATGAGTCTTCGGACCTCGC
788 bp
412 bp
193 bp
134 bp
  1. apBacPAK8 was from Clontech (Palo Alto, CA, USA), pRL-CMV, pGL3 and pRL-TK were from Promega (Madison, WI, USA). The 5'LTR promoter sequence was kindly provided by S. Somogyi.
  2. bRestriction sites added to the primers for cloning purposes are italicised.