Skip to main content

Table 2 Primers used to sequence codons in p53 and K-ras2 that experience a high incidence of mutation during carcinogenesis. The designations "for" and "rev" indicate whether the anti-sense or sense strand was sequenced, respectively.

From: Characterization of mutations and loss of heterozygosity of p53 and K-ras2 in pancreatic cancer cell lines by immobilized polymerase chain reaction

Primer Name Sequence
p53 c175 pos1 for gcacatgacggaggttgtgagg
p53 c175 pos2 for gcacatgacggaggttgtgaggc
p53 c175 pos3 for gcacatgacggaggttgtgaggcg
p53 c175 pos3 rev cagcgctcatggtggggggca
p53 c175 pos2 rev cagcgctcatggtggggggcag
p53 c245 pos1 for gtaacagttcctgcatgggc
p53 c245 pos2 for gtaacagttcctgcatgggcg
p53 c245 pos3 for gtaacagttcctgcatgggcgg
p53 c248 pos1 for cctgcatgggcggcatgaac
p53 c248 pos2 for cctgcatgggcggcatgaacc
p53 c248 pos3 for cctgcatgggcggcatgaaccg
p53 c249 pos3 rev gtgatgatggtgaggatggg
p53 c249 pos2 rev gtgatgatggtgaggatgggc
p53 c249 pos1 rev gtgatgatggtgaggatgggcc
p53 c273 pos1 for gacggaacagctttgaggtg
p53 c273 pos2 for gacggaacagctttgaggtgc
p53 c273 pos3 for gacggaacagctttgaggtgcg
p53 c282 pos1 for gtgcctgtcctgggagagac
p53 c282 pos2 for gtgcctgtcctgggagagacc
p53 c282 pos3 for gtgcctgtcctgggagagaccg
kras c12 pos1 for aacttgtggtagttggagct
kras c12 pos2 for aacttgtggtagttggagctg
kras c12 pos3 for aacttgtggtagttggagctgg
kras c13 pos3 rev gtcaaggcactcttgcctac
kras c13 pos2 rev gtcaaggcactcttgcctacg
kras c13 pos1 rev gtcaaggcactcttgcctacgc
kras c61 pos1 for atattctcgacacagcaggt
kras c61 pos2 for atattctcgacacagcaggtc
kras c61 pos3 for atattctcgacacagcaggtca