Skip to main content

Table 1 Primers used to polony amplify p53 and K-ras 2 exons bearing mutational hotspots from pancreatic cancer cell line genomic DNA.

From: Characterization of mutations and loss of heterozygosity of p53 and K-ras2 in pancreatic cancer cell lines by immobilized polymerase chain reaction

Primer Name Sequence
p53 exon5 forward tgccctgactttcaactctgtctccttcctc
p53 exon5 reverse ccagacctaagagcaatcagtgaggaatcagaggc
p53 exon7 forward gttatctcctaggttggctctgactgtacca
p53 exon7 reverse gtggatgggtagtagtatggaagaaatcggt
p53 exon8 forward ggtaggacctgatttccttactgcctcttgc
p53 exon8 reverse gataaaagtgaatctgaggcataactgcacc
kras exon1 forward tggtggagtatttgatagtgtattaaccttatgtg
kras exon1 reverse agagaaacctttatctgatatcaaagaatggtcctg
kras exon2 forward tgaagtaaaaggtgcactgtaataatccagac
kras exon2 reverse taatgtcagcttattatattcaatttaaacccacc