Skip to main content

Table 1 Primer sequences

From: Signal and noise in bridging PCR

Primer name 5'- sequence -3'
Jp GCGAGTCAGTGAGCGAGG
b1 GTCGACCTGCAGGCATGCA
b2 CCCGACACACGTGCTTGG
M13 pI GTCTGTGCCACGTATTCT
M13 pV GCTGTTGCCCGTCTCGCTG
M13revI CTGGCACGACAGGTTTCCCGA
PIII GCAACTGTTGGGAAGGGCGATCG