Skip to main content

Table 1 TaqMan PCR primers and probes

From: Simultaneous silencing of multiple RB and p53 pathway members induces cell cycle reentry in intact human pancreatic islets

Primer/Probe Sequence
RB F1 5′- GGAAGCAACCCTCCTAAACC - 3′
RB R1 5′ - TTTCTGCTTTTGCATTCGTG - 3′
RB probe 5′ - [6-FAM] CATCTCCCAGGAGAGTCCAA [BHQ1a-6FAM] - 3′
p107 F1 5′ – AGAATGCCTCCTGGACCTTT - 3′
p107 R1 5′ – GGGGTGTCACGAGTGAACTT - 3′
p107 probe 5′ - [6-FAM] ACGCAGAAGAGGAAATTGGA [BHQ1a-6FAM] - 3′
p130 F1 5′ – ATTTGGCATGGAAACCAGAG - 3′
p130 R1 5′ – GTCACCCTTCTGGGAGTCAA - 3′
p130 probe 5′ - [6-FAM] AGAACCTGGAAAGGGCAGAT [BHQ1a-6FAM] - 3′
p21 F1 5′ – AGAGGAGGCGCCATGTCAG - 3′
p21 R1 5′ – CATTAGCGCATCACAGTCGC - 3′
p21 probe 5′ - 6-FAM] CAGAACCCATGCGGCAGCAA [BHQ1a-Q] - 3′
p53 F1 5′ – GTGGAAGGAAATTTGCGTGT - 3′
p53 R1 5′ – CCAGTGTGATGATGGTGAGG - 3′
p53 probe 5′ - [6-FAM] ACATAGTGTGGTGGTGCCCT [BHQ1a-Q] - 3′
ARF F1 5′ – AGGGTTTTCGTGGTTCACAT - 3′
ARF R1 5′ – CTGCCCATCATCATGACC - 3′
ARF probe 5′ - [6-FAM] CGATCCAGGTCCATGATGATG [BHQ1a-6FAM] - 3′
GAPDH F1 5′ – GAGTCAACGGATTTGGTCGT - 3′
GAPDH R1 5′ – TTGATTTTGGAGGGATCTCG - 3′
GAPDH probe 5′ - [6-FAM] CTGAGAACGGGAAGCTTGTC [BHQ1a-6FAM] - 3′