Skip to main content

Table 3 The sequences and information of LAMP primers

From: Rapid and simple detection of methicillin-resistance staphylococcus aureus by orfXloop-mediated isothermal amplification assay

Label 5′pos 3′pos len Tm 5′dG 3′dG GCrate Sequence
F3 204 222 19 56.03 -5.56 -4.06 0.42 ACCACAATCMACAGTCATT
B3 398 415 18 55.58 -7.53 -4.56 0.50 CCCGCATCATTTGATGTG
FIP    39      CAAAGTCGCTTTGCCCTTGG-GATGCTATCTTCCGAAGGA
BIP    41      GATCAAACGGCCTGCACAAG-GRAATGTCATTTTGCT RAATG
F2 243 261 19 55.33 -5.14 -4.71 0.47 GATGCTATCTTCCGAAGGA
F1c 291 310 20 61.82 -4.16 -5.45 0.55 CAAAGTCGCTTTGCCCTTGG
B2 377 397 21 55.47 -4.51 -4.07 0.38 GR(G or A)AATGTCATTTTGCTRAATG
B1c 326 345 20 61.55 -3.92 -4.66 0.55 GATCAAACGGCCTGCACAAG
LF 266 286 21 61.30 -6.24 -5.45 0.48 TGCGTTGGTTCAATTCTTGGG
LB 346 367 22 60.11 -5.26 -3.73 0.45 GACGTCTTACAACGCAGTAACT