Skip to main content

Table 5 Nucleotide sequences of the qPCR primers and probes used in the present study

From: Reduction in C-terminal amidated species of recombinant monoclonal antibodies by genetic modification of CHO cells

  Forward primer Reverse primer Probe
GLUC ATTGCCAAACGCCACGAT CCAAGCAATGAATTCCTTTGC CTGAAGGGACCTTTACCA
PAM GCCCCAGCTCGGACATG CCTTGCAGGGCGAGCA CCGGCTGCTGCTGCT
  1. GLUC, glucagon; PAM, peptidylglycine amidating monooxygenase.