Skip to main content

Table 4 Nucleotide sequences of the shRNAs used in the present study

From: Reduction in C-terminal amidated species of recombinant monoclonal antibodies by genetic modification of CHO cells

Name shRNA top strand oligonucleotide shRNA bottom strand oligonucleotide
shRNA_sh5 GATCCGAACTGACACCAAAGAATTCTCAAGAGAAATTCTTTGGTGTCAGTTCTGTTTTTTGGAAA AGCTTTTCCAAAAAACAGAACTGACACCAAAGAATTTCTCTTGAGAATTCTTTGGTGTCAGTTCG
shRNA_sh6 GATCCGTTTCAGAACTGACACCAAACTCAAGAGATTTGGTGTCAGTTCTGAAACATTTTTTGGAAA AGCTTTTCCAAAAAATGTTTCAGAACTGACACCAAATCTCTTGAGTTTGGTGTCAGTTCTGAAACG