Skip to main content

Table 3 Nucleotide sequences of the siRNAs used in the present study

From: Reduction in C-terminal amidated species of recombinant monoclonal antibodies by genetic modification of CHO cells

Name siRNA oligonucleotide Supplier
siRNA_si1 CAGUUGUGUGUGGCAGACAGGGAAA Invitrogen
siRNA_si2 CGGAUCCAAUGUUUCAGAACUGACA Invitrogen
siRNA_si3 CCAAUGUUUCAGAACUGACACCAAA Invitrogen
siRNA_si4 GAGAGAGAUUAAACAUGCGUCAUUU Invitrogen
siRNA_si5 CAUGCGUCAUUUGGGAGAAAUGUAU Invitrogen
siRNA_si6 UGGGAGAAAUGUAUUCGCAAUUUCA Invitrogen
siRNA_si7 GGGAGAAAUGUAUUCGCAAUUUCAU Invitrogen
siRNA_si8 CACACGAACACGGUGUGGAAGUUCA Invitrogen
siRNA_si9 CAAAGAAACCGAGGCAGUUGUUGAA Invitrogen
siRNA_si1 CAGUAAAUGGGAAGCCUUATT Ambion
siRNA_si2 AGGCAGUUGUUGAAUCCAATT Ambion
siRNA_si3 AACAGAAACUGAUCAAAGATT Ambion
siRNA_si4 CAAGAGAAACAGAAACUGATT Ambion
siRNA_si5 GAACUGACACCAAAGAAUUTT Ambion
siRNA_si6 UUUCAGAACUGACACCAAATT Ambion