Skip to main content

Table 2 Primers and probes used for quadruplex real-time PCR assays in this study

From: A novel quadruplex real-time PCR method for simultaneous detection of Cry2Aeand two genetically modified cotton events (GHB119 and T304-40)

Target Purpose Primer/probe name Sequence (5′-3′) Amplicon length (bp) Reference
18S rRNA Eukaryotes gene 18SrRNA-F CCTGAGAAACGGCTACCAT 137 19
18SrRNA-R CGTGTCAGGATTGGGTAAT
18SrRNA-P FAM-TGCGCGCCTGCTGCCTTCCT –BHQ1
ACP1 Cotton endogenous gene ACP-FP ATGAACCAGGGAAGAAGCACC 97 This study
ACP-RP CCTTATCCACGGTCTCTTGTTTG
ACP-P ROX-CATTTACGATGCGTCCAATGCCTG-BHQ2
GHB119 Event-specific detection GHB119-F1 AAAACTTTGTGCAGCCTTCG 130 This study
GHB119-R2 CGCAAACTAGGATAAATTATCGC
GHB119-P FAM-TCCCCCTATCTTGCTAAATGGCTCC-BHQ1
T304-40 Event-specific detection T304-F1 GTCATTGTAGGGAGTTTGTCCAA 118 This study
T304-R2 CTGTAGCCACAACACCACTTTG
T304-P HEX-TTAATCCCAGTACTCGGCCGTC-BHQ1
Cry2Ae Gene-specific detection CRY2E-F1 CTTGCTCTACTTTCCTTCCTCC 114 This study
CRY2E-R2 CGAAAGACTCAGTTTGCCAGT
CRY2E-P CY5-CAAGCCAAGA + C + CTAACGAAAGGAG-BHQ3*
  1. *The base before symbol “+” was decorated with LNA.
\