Skip to main content

Table 1 Sets of forward and reverse primers used in the experiments

From: Development of selectable marker free, insect resistant, transgenic mustard (Brassica juncea) plants using Cre/loxmediated recombination

Primers Sequences Annealing temperature (°C) Amplicon size (bp)
A1 (ASAL forward) 5′ATGGCCAGGAACCTACTGACGA 3′ 56 362
B1 (ASAL reverse) 5′CTATCTTCTCTAGGTACCAGTA 3′   
A2 (cre forward) 5′ ATGTCCAATTTACTGACC 3′ 58 1100
B2 (cre reverse) 5′ CTAATCGCCATCTTCCAGC 3′   
A3 (hpt forward) 5′ GCTTTCCACTATCGGCGA 3′ 58 980
B3 (hpt reverse) 5′ AAAGCCTGAACTCACCGC 3′