Skip to main content

Table 1 Oligonucleotide primers used in this study

From: Simultaneous display of two large proteins on the head and tail of bacteriophage lambda

Name Sequence (5′-->3′)
KM491, FOR (GTC)4actagtGTGAGCAAGGGCGAGGAGCTGTTC
KM492, REV (GTC)4gcggccgcCCTTGTACAGCTCGTCCATGCCGA
KM493, FOR (GTC)4actagt TAGGTGAGCAAGGGCGAGGAGCTGTTC
KM494, REV (GTC)4gcggccgcTTACTTGTA CAGCTCGTCCATGCCGA
KM549, FOR ATGCTGGACACCTCC TGTGGTTCTGGATCAGGTTCTGGA GTGAGCAAGGGCGAGGAG CTGTTCA
KM550, REV AACCAGCTTACGGCT ACATCCAGAACCTGATCCAGAACC CTTGTACAGCTCGTCCATG CCGAG
KM553, FOR GCGTGGGATGGCACC TGTGGTTCTGGATCAGGTTCTGGA GTGAGCAAGGGCGAGG AGCTGTTC
KM554, REV GGCAGCACCGTCGGT ACATCCAGAACCTGATCCAGAACC CTTGTACAGCTCGTCCAT GCCGAG
KM555, FOR GCCAGCGACGAGACG TGTGGTTCTGGATCAGGTTCTGGA TGAGCAAGGGCGAGGAG CTGTTCA
KM556, REV AAACGCGGTCCGTTTTTT ACATCCAGAACCTGATCCAGAACC TTGTACAGCTCGTCCAT GCCGAG
K47, FOR GGGCACTCGACCGGAATTATCG
KM541, REV CTCGCCCTTGCTCAC TCCAGAACCTGATCCAGAACCACA GGAGGTGTCCAGCATCA GCGGGGT
KM543, REV CTCGCCCTTGCTCAC TCCAGAACCTGATCCAGAACCACA GGTGCCATCCCACGCAA CCAGCTT
KM544, REV CTCGCCCTTGCTCAC TCCAGAACCTGATCCAGAACCACA CGTCTCGTCGCTGGCAG CCTCCGG
KM545, FOR GACGAGCTGTACAAG GGTTCTGGATCAGGTTCTGGATGT AGCCGTAAGCTGGTTGCGT GGGAT
KM547, FOR GACGAGCTGTACAAG GGTTCTGGATCAGGTTCTGGATGT ACCGACGGTGCTGCCG TTGGCA
KM548, FOR GACGAGCTGTACAAG GGTTCTGGATCAGGTTCTGGATGT AAAAAACGGACCGCGTTT GCCGGA
KM60, REV GATTTAATCTGTATCAGGCTGA
KM 513, REV TACGGCTGGAG GTGTCCAGCATCAG
K86, REV CTCTCATCCGCCAAAACAGCC
KM512, FOR CTGATGCTGGACACCTCCAGCCGTA
KM526, FOR GTCGTCGTCgcggccgcAAGGAGGAAATCCTCATGCCTGTACCAAATCCTACAATG
KM527, REV CCCTTTCACCACCGA GGTGCTG
KM530, FOR GAGGTGCAGCTGTTGGAGTCT
K48, REV GGTATGAGCCGGGTCACTGTTG
KM215 TCAGGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCG
KM528, FOR AGCACCTCGGTGGTGAAAGGGTCAGGTGGA
KM529, REV CTCCAACAGCTGCACC TCCGATCCGCCACC
SM132, FOR GTCGTCGTCactagtTAG TCAGGCGGTGGATCAGGCGGTGGATCAGGCGGTGGATCACGGACACCAGAAATGCCTGTTCTG
SM133, REV GTCGTCGTCctgcagTTATTTCAGCCCCAGAGCGGCTTTCATG
SM134, FOR GTCGTCGTCctgcagAAGGAGGAAATCCTCATGCCTGTA