Skip to main content

Table 2 Oligonucleotide primers used in this study

From: High level transient production of recombinant antibodies and antibody fusion proteins in HEK293 cells

Primer 5’→3’ REN
TS_pCMVFc_Leader_f1 CTGGCACGTGGAAATTAATTAAACGCCGCCAACATGGGATGGAGCTGT PmlI
TS_pCMVFc_NheI_r1 AGATGCTAGCGGCCGCAGATCTGGGCCCGGATTCCTGCAGCTGGACCTGTGCCATGGAGTGCGCGCCTGTGGAGAGA NheI, NcoI
TS_hIgG1CH2_SacII_f ACGGCGTGGAGGTGCATAATGCCAAGAC  
TS_pCMV2.1_r AGCTTCTAGACTCATTTACCCGGGGACAGGGAGA XbaI
TS_pCMV2.2_r AGCTTCTAGACGCACTCATTTACCCGGGGACAGGGAGA XbaI
TS_pCMV2.3_r AGCTTCTAGAGCCGGCCGTCGCACTCATTTACCCGGGGACAGGGAGA XbaI
TS_pCMV2.4_r AGCTTCTAGATTCATTTACCCGGGGACAGGGAGA XbaI
TS_pCMV2.5_r AGCTTCTAGATTTATTTACCCGGGGACAGGGAGA XbaI
TS_pCMV3.2_r AGCTTCTAGACGCACTCATCCCGGGGACAGGGAGA XbaI
TS_pCMV4.2_r AGCTTCTAGACGCACTCAGGATCCCGGGGACAGGGAGA XbaI
MHdCpCMV-NotI_f GATCTGCGGCCGCTAGCGACAAAACTCACACATGCC NotI
MHCH2-SacII_r CTCCTCCCGCGGCTTTGTCTTGG SacII
TS_oriP_PmeI-PvuII_f GACTCAGCTGTTTAAACGAACTAAACCTGACTACG PvuII, PmeI
TS_oriP_FR_BsmBI/PciI_r CACTCGTCTCACATGTATTCTCATGTTTGACAGC BsmBI/PciI
TS_pUCori_MfeI_f CAGTCAATTGGGATATCGCAGGAAAGAGCATGTGAGC MfeI, EcoRV
TS_5’CMV_MfeI_r CTGTCAATTGTGAATTCGATACCGATCTC MfeI, EcoRI
TS_oriPspacer_Pci_r CAACACATGTCAACATTAGCCCACCGTGC PciI
TS_oriPspacer_Pml_f: AGATCACGTGTAGGTGGGCGGGCCAAGA PmlI
  1. a underlined: ribosomal binding site (modified KOZAK sequence).
  2. Abbreviations: REN restriction endonuclease cloning site.