Skip to main content

Table 1 pCMV-hIgG1Fc-XP vectors with modified 3′ translation termination sequences

From: High level transient production of recombinant antibodies and antibody fusion proteins in HEK293 cells

pCMV 5→3’ Features
- TCTCCCTGTCCCCGGGTAAATGA GGATCCTCTAGAAGCT opala, BamHI, XbaI
2.1 TCTCCCTGTCCCCGGGTAAATGA GTCTAGAAGCT opal + 1 nt, XbaI
2.2 TCTCCCTGTCCCCGGGTAAATGA GTGCGTCTAGAAGCT opal + 5 nts, XbaI
2.3 TCTCCCTGTCCCCGGGTAAATGA GTGCGACGGCCGGCTCTAGAAGCT opal + 14 nts, XbaI
2.4 TCTCCCTGTCCCCGGGTAAATGA ATCTAGAAGCT opal + dA, XbaI
2.5 TCTCCCTGTCCCCGGGTAAATAA ATCTAGAAGCT ochre + dA, XbaI
3.2 TCTCCCTGTCCCCGGGATGA GTGCGTCTAGAAGCT ΔK330b, opal + 5 nts, XbaI
4.2 TCTCCCTGTCCCCGGGATCCTGA GTGCGTCTAGAAGCT K330Sb, c, BamHI, opal + 5 nts, XbaI
  1. Abreviations: nt, desoxynucleotide(s) derived from human IgG gene sequences; dA, desoxy-adenine.
  2. underlined … stop codon, bold letter… desoxynucleotide downstream from the stop codon also termed as “forth nucleotide of the stop codon” is important efficient for translation termination.
  3. a Frequent mutations of opal (TGA) to TTA were observed which might be due to the immediately following BamHI and XbaI sites.
  4. b Numbering according to Uniprot: P01857.
  5. c Additional BamHI fusion site.