Skip to main content

Table 2 Oligonucleotide primers used in this study

From: Strategy for successful expression of the Pseudomonas putida nitrile hydratase activator P14K in Escherichia coli

Name Sequence
A-up 5’-GGAATTCCATATGGGGCAATCACACACGC-3’
P-down 5’-CCGGAATTCTCAAGCCATTGCGGCAACGA-3’
B-down(rbs) 5’-ATATCTATATCTCCTTTCACGCTGGCTCCAGGTAGTC-3’
P-up(rbs) 5’-TGAAAGGAGATATAGATATGAAAGACGAACGGTTT-3’
P-up 5’-GGAATTCCATATGAAAGACGAACGGTTT-3’
P-down(PAB) 5’-CATATCTATATCTCCTTTCAAGCCATTGCGGCAACG-3’
A-up(PAB) 5’-TGAAAGGAGATATAGATATGGGGCAATCACACACGC-3’
B-down(PAB) 5’-CCGGAATTCTCACGCTGGCTCCAGGTAGT-3’
Po-up 5’-GGAATTCCATATGAAAGACGAACGTTTC-3’
Po-down 5’-CCGGAATTCTCAAGCCATAGCAGCAACAA-3’
B-down(strep) 5’-GCGGGTGGCTCCAGCTTGCCATATCTATATCTCCTTTCACGCTGGCTCCAGGTAGTCATC-3’
P-up(strep) 5’-AAGCTGGAGCCACCCGCAGTTCGAAAAGGGTGCAAAAGACGAACGGTTTCCATT-3’
K2A-up 5’-TGAAAGGAGATATAGATATGGCGGACGAACGGTTTC-3’
K2A-down 5’-GCAATGGAAACCGTTCGTCCGCCATATCTATATCTCC-3’
P-up(N) 5’-TGAAAGGAGATATAGATATGGGCCCTGTGTTTGACG-3’
A-down(strep) 5’-GCGGGTGGCTCCAGCTTGCCATATCTATATCTCCTTTTAATGAGATGGGGTGGGTTGGGT-3’
secA-up 5’-CCGGAATTCGGGGCAATCACACACGCAT-3’
secB-down 5’-GATATCCATGGCCATCGCCGGCTGGGCAGCGAGGAGCAGCAGACCAGCAGCAGCGGTCGGCAGCAGGTATTTCATATGTATATCTCCTTTCACGCTGGC-3’
secP-up 5’-CAGCCGGCGATGGCCATGGATATCGGAATTAATGCAAGCTGGAGCCACCCGCAGTTCGAAAAGGGTGCAAAAGACGAACGGTTTCCATTGCCAG-3’
secP-down 5’-CGACCCAAGCTTTCAAGCCATTGCGGCAACGACC-3’
  1. Italicized letters denote the NdeI, EcoRI and HindIII recognition sites, respectively.