Table 5 Primers used in this study
From: Metabolic evolution of Corynebacterium glutamicum for increased production of L-ornithine
Primer | Sequence* | Purpose |
|---|---|---|
sacBF | cggcgactagttgagctgttgacaattaatcatcgtgtggtaccatgtgtggaattgtgagcggataacaattccgcgggttctttaggcccgtagtct (SpeI,SacII) | PCR for the sacB gene |
sacBR | gccgcgatatctctcgtgatggcaggtt (EcoRV) | PCR for the sacB gene |
pk18msF | gcgccgatatcgttcgtctggaaggcagta (EcoRV) | PCR for the backbone of pK18mobsacB except for the sacB gene |
pk18msR | gcgcgactagtgcatgggcataaagttgc (SpeI) | PCR for the backbone of pK18mobsacB except for the sacB gene |
argR-F5 | cgct ggatcc tttaagcacggcgttattt (BamHI) | PCR for the upstream fragment of the argR gene |
argR-R5 | cgg tctaga tgcgagtcacgggattta (XbaI) | PCR for the upstream fragment of the argR gene |
argR-F3 | cgg tctaga ggtaaggtataacccgagtgt (XbaI) | PCR for the downstream fragment of the argR gene |
argR-R3 | cgat gtcgac gacttgatgcccacgaga (SalI) | PCR for the downstream fragment of the argR gene |
GargBF | cgctctagaaaggacacaggcatgaatgact (XbaI) | PCR for the argB gene from C. glutamicum |
GargBR | cgggtcgacttacagttccccatcctt (SalI) | PCR for the argB gene from C. glutamicum |
EargBF | cgttctagaaggaggggtgcaatgatgaat (XbaI) | PCR for the argB gene from E. coli |
EargBR | gcggtcgaccttaagctaaaatccg (SalI) | PCR for the argB gene from E. coli |
zwf-F | ccgcctctagaaaggagaccatcatgagcacaaacac (XbaI) | PCR for the zwf gene from C. glutamicum |
zwf-R | cggtagtcgacccctaaattatggcctgc (SalI) | PCR for the zwf gene from C. glutamicum |
ppnK-F | gccatgaattcaaggacgcaataatgactgcacccacgaa (EcoRI) | PCR for the ppnK gene from C. glutamicum |
ppnK-R | ccgccgagctccgaattaccccgctgac (SacI) | PCR for the ppnK gene from C. glutamicum |
gnd-F | gcgatggtaccaaggagaccactatgccgtcaagtacgat(KpnI) | PCR for the gnd gene from C. glutamicum |
gnd-R | ccgcgtctagaaaaggagagcctttaagct (XbaI) | PCR for the gnd gene from C. glutamicum |
pntAB-F | cagggtacctcatcaataaaaccg(KpnI) | PCR for the pntAB gene from E. coli |
pntAB-R | cgtctgcagttacagagctttcag(PstI) | PCR for the pntAB gene from E. coli |
qpgiF | cccttctattctcggtgc | qRT-PCR for pgi |
qpgiR | aggtcatttgcctgctgt | qRT-PCR for pgi |
qpfkAF | tatccctgttgtcggtgtc | qRT-PCR for pfkA |
qpfkAR | gtgagattcagcggtggt | qRT-PCR for pfkA |
qgapF | ggaagttgaatacgacgatga | qRT-PCR for gap |
qgapR | gcccagtccaggttcttt | qRT-PCR for gap |
qpycF | accgccacgaaatccc | qRT-PCR for pyc |
qpycR | aacggctgcgtagttgtct | qRT-PCR for pyc |
qpykF | ccgtgcagtcggtattct | qRT-PCR for pyk |
qpykR | gcgttccctctacatcgt | qRT-PCR for pyk |
qgltAF | cgggaatcctgcgttac | qRT-PCR for gltA |
qgltAR | tggcgaatctcgtcgtt | qRT-PCR for gltA |
qgdhF | ccgccacatcggtgagta | qRT-PCR for gdh |
qgdhR | agccatgcgacggtagt | qRT-PCR for gdh |
qargBF | ggtttggtcggagacatca | qRT-PCR for argB |
qargBR | gcctggagcaatcgtagag | qRT-PCR for argB |
qargJF | cctgacatggcgttgg | qRT-PCR for argJ |
qargJR | ctcggctcaccttcaca | qRT-PCR for argJ |
qzwfF | acccgcaggataaacga | qRT-PCR for zwf |
qzwfR | gctagatcataaatggc | qRT-PCR for zwf |
qppnkF | gtttaccgaccgacttgtg | qRT-PCR for ppnk |
qppnkR | gctgacctgggatctttatt | qRT-PCR for ppnk |
qicdF | aggaccagggctacgacat | qRT-PCR for icd |
qicdR | gcggaacccttaacagc | qRT-PCR for icd |
qgndF | aaccgcagcactgacaaa | qRT-PCR for gnd |
qgndR | cagggatgctacgaactct | qRT-PCR for gnd |
16s-F | tcgatgcaacgcgaagaac | qRT-PCR for 16srRNA |
16s-R | gaaccgaccacaagggaaaac | qRT-PCR for 16srRNA |