Skip to main content

Advertisement

Table 1 Oligonucleotides used in this study as primers for PCR

From: Cloning, overexpression, purification, and characterization of a polyextremophilic β-galactosidase from the Antarctic haloarchaeon Halorubrum lacusprofundi

Primer 5-3 sequence Use
cspD2F CGGGGTACCGGCACTGCACAGCCGATGCT Amplification of cspD2 promoter
cspD2R GGAATTCCATATGCAATCAACCGTTGGGCCG
HlaR CGGGATCCCTACGTCTGAGCGATTCT Amplification of bga gene
HlaF GGGAATTCCATATGCGTCTCGGAGTCTG
β-gal 05R TCGAAGGAGCCGTACTGCTG Sequencing of bga gene
β-gal 15 F CCGTCGATCAGCACGAGTCG
β-gal 04 F GATTGTGCCGACGCGTTCCG
β-gal 16R TCCAGCCACTCCGCCCAGGT
β-gal 11R TCCTCGGACGTGTGTGCGGC
β-gal l10F GCACCACGCCGCCGCCCACG
pKJprmhtrF TTATTCCGTTTCCGCGGAAA Sequencing of cspD2 promoter in pMC2 plasmid
pKJprmhtrR GTCGTCCTCGTTGTCCCCGA