Skip to main content

Table 2 Primer for vector amplification and complementary primer extensions for gene of interest

From: A new method to customize protein expression vectors for fast, efficient and background free parallel cloning

LP1 forward vector primer
3C 5' GGGCCCCTGGAACAGAACTTCCAG 3'
Sumo1 5' TCCACCGGTTTGTTCCTGGTAGAC 3'
Sumo3 5' TCCACCGGTCTGCTGCTGGAACAC 3'
N-tagless pET 5' GGTATATCTCCTTCTCTAGAGGGGAATTGTTATCCGCTC 3'
N-tagless pFastBac 5' GGAATTCCGCGCGCTTCGGACC 3'
LP2 reverse vector primer  
ccdB 5' CGCCATTAACCTGATGTTCTGGGG 3'
10His 5' GAGCATCATCATCATCACCAC 3'
OneStrep 5' AGCGCTTGGAGCCACCCGCAG 3'
S 5' AAAGAAACCGCTGCTGCTAAATTCG 3'
HPC4 5' GAGGACCAGGTGGACCCCCGG 3'
LP1 forward gene primer  
3C 5' AAGTTCTGTTCCAGGGGCCC – GOI seq 3'
Sumo1 5' GTCTACCAGGAACAAACCGGTGGA – GOI seq 3'
Sumo3 5' GTGTTCCAGCAGCAGACCGGTGGA – GOI seq 3'
LP2 reverse gene primer  
ccdB 5' CCCCAGAACATCAGGTTAATGGCG - Stop - GOI - seq 3'
10His 5' GTGGTGATGATGATGATGCTC - Stop - GOI - seq 3'
OneStrep 5' CTGCGGGTGGCTCCAAGCGCT - Stop - GOI - seq 3'
S 5' AGCAGCAGCGGTTTCTTT - Stop - GOI - seq 3'
CBP 5' CTTCCACCGCCGCTTCATC - Stop - GOI - seq 3'
HPC4 5' GGGGTCCACCTGGTCCTC – Stop - GOI - seq 3'
Æ54CPD54 5' CAGGATCTTGCCGCTGCC – Stop - GOI - seq 3'