Skip to main content

Table 2 Oligonucleotides used in this study

From: An improved genetic system for bioengineering buoyant gas vesicle nanoparticles from Haloarchaea

Oligonucleotide 5′-3′ sequence Use
gvpCdel5F CGCAAGCTTATTACTTCTCTCCAGTCGATG gvpC deletion construction
gvpCdel5R GCGGGCAGTACTCATCTCGTCCTCGAGGCGTTTGTCTGTGACACTCAT
gvpCdel3F GACGAGATGAGTACTGCCCGCCGGCCGGATGATAAAACATGA
gvpCdel3R CGCAAGCTTACTCGTTGTAGACCAGCGTTG
gvpA-NdeI CTCAAGGTATACCACTAGACCCTAAT Amplification of gvpA promoter
gvpA-KpnI ACTCATGGTACCTACTTCTCTCCAGT
gvpC-F1AflIIGvpC-F GGTGTGCTTAAGATGAGTGTCACAGACAAA gvpC gene segment amplification
gvpC-C1RAvrIIGvpC CAGCCTAGGGTGGGTTGAGTTCATCTCTGT
gvpC-C2RAvrIIGvpC CTGCCTAGGCGCGGTAGCGTCGAAGCTGTC
gvpC-C3RAvrIIGvpC GTGCCTAGGTTCTGCTTCCGCTTCGAC
gvpC-C4RAvrIIGvpC AGACCTAGGTGTTTTATCATCCGGCCG
gvpC-His-adapter F CGTCTCCATATGCACCACCACCACCACCACCTTAAGCGTCTACCTAGGAGCGCTTGAGGATCCATC His-tag adapter for gvpC and antigen fusion expression plasmid construction
gvpC-His-adapter R GATGGATCCTCAAGCGCTCCTAGGTAGACGCTTAAGGTGGTGGTGGTGGTGGTGCATATGGAGACG
pKJ-cspD2F GCTGGACTGCCTTTTCTTCG Sequencing of promoters and inserts in pARK and pDRK series plasmids
pKJ-BamH1-3′160R GTTACTCCACCGTCATTCAG
Universal F 20mer GTTGTAAAACGACGGCCAGT Sequencing across gvpC deletion
Universal R 20mer CACAGGAAACAGCTATGACC
Luci Int R GTGGCTGAGGCAGATGAGGC Sequencing and determination of luciferase gene orientation