Skip to main content

Table 2 Resources for simplified counter-selection recombineering

From: A simplified counter-selection recombineering protocol for creating fluorescent protein reporter constructs directly from C. elegans fosmid genomic clones

    RT-cassette-containing constructb Replacement constructc
Desired insertion sequencea RT kbd Fwd (5-3)e Rev (5-3)e pCC1Fos-based pGOv5-based kbf
RT-cassette pNH034 2.0 GCTGTCGAGATATGACGGTGTTCA TCTTGGAGTGGTGAATCCGTTAGC - -  
F-CFP pNH050 2.4 ATGAGTAAAGGAGAAGAACTTTTC [*]TTTGTATAGTTCATCCATGCCATG pNH039 n/a 0.9
F-GFP pNH051 2.4 ATGAGTAAAGGAGAAGAACTTTTC [*]TTTGTATAGTTCATCCATGCCATG pNH040 n/a 0.9
F-YFP pNH052 2.4 ATGAGTAAAGGAGAAGAACTTTTC [*]TTTGTATAGTTCATCCATGCCATG pNH041 n/a 0.9
Mc-mCherry pNH053 2.4 ATGGTCTCAAAGGGTGAAGAAGAT [*]GGATCCACTAGTCTTATACAATTC pNH042 n/a 0.9
mTFP1 pNH054 2.4 ATGGCCGCCTCAAAAGGAGAAGAA [*]AGCGCTTACGTAGAGCTCGTCCAT pNH043 pNH013 0.7
N-TAP-tag::[(G4S)3]::mTFP1 pNH066 2.6 ATGGTTAAAGAAACAGCAGCAGCG [*]AGCGCTTACGTAGAGCTCGTCCAT pNH058 pNH002 0.9
mTFP1::[(G4S)3]::C-TAP-tag pNH094 2.3 ATGGCCGCCTCAAAAGGAGAAGAA [*]AGCCCATGAGTCCATATGCTGTCT pNH090 pNH026 0.9
mTFP1::[(G4S)3]::2xNLS pNH070 2.6 ATGGCCGCCTCAAAAGGAGAAGAA [*]AGCGCTAACTTTTCGCTTCTTCTT n/a pNH030 0.8
mTFP1[B] pNH054 2.4 ATGGCCGCCTCAAAAGGAGAAGAA [*]AGCGCTTACGTAGAGCTCGTCCAT n/a pNH078 0.8
mTFP1[BC] pNH054 2.4 ATGGCCGCCTCAAAAGGAGAAGAA [*]AGCGCTTACGTAGAGCTCGTCCAT n/a pNH082 0.8
  1. a sequence to be seamlessly inserted into target; b the counter-selection RT-cassette should be PCR-amplified from this construct using, as template, the RT-cassette-containing NotI-NotI fragment; c the desired replacement cassette can be excised, as a NotI-NotI fragment, from either the pCC1Fos- (if available) or parental pGOv5-based (Table 1) constructs; d size of the isolated NotI-fragment (or NcoI-NcoI fragment for pNH034) to be used as PCR template; e suggested 3 sequences of ‘recombineering’ ODNs designed to PCR-amplify FP-flanked, RT-cassette-containing sequence. Reverse ODN sequence lacks a 5 stop triplet [*]; f size of the isolated NotI-fragment to be used to replace the inserted FP-flanked, RT-cassette-containing sequence. All constructs are available from Addgene and are in E. coli EPI300 apart from those built in pGOv5 which are in E. coli DH5α.