Skip to main content

Table 1 PCR primers (cloning sites are indicated by underscore)

From: A vaccine grade of yeast Saccharomyces cerevisiae expressing mammalian myostatin

Name Sequence (5’ → 3’)
LoxP-KanMX4-F GCGAATTCATAACTTCGTATAATGTATGCTATACGAAGTTATGTTTAGCTTGCCTCGTCC
LoxP-KanMX4-R GCGGATCCATAACTTCGTATAGCATACATTATACGAAGTTATGTTTTCGACACTGGATGG
NTS2-5’-F CACAAGAGGTAGGTCGAAACAGAACATGAAAGTTGGTCGGTAGGTGC
NTS2-5’-R TCGAGCACCTACCGACCAACTTTCATGTTCTGTTTCGACCTACCTCTTGTGGTAC
NTS2-3’-F GGCCGCCAGAGGTAGTTTCAAGGTGACAGGTTATGAAGATATGGTGCAAAACCGC
NTS2-3’-R GGTTTTGCACCATATCTTCATAACCTGTCACCTTGAAACTACCTCTGGC
ADH1-F GCCTCGAGAAAACAAGAAGAGGGTTGAC
ADH1-R GTATATGAGATAGTTGATTG
CYC3-F ATCATGTAATTAGTTATGTC
CYC3-R GCGAATTCGCAAATTAAAGCCTTCGAGC
MSTN-F ATCAACTATCTCATATACATGCAAAAACTGCAAATCTA
MSTN-R CATAACTAATTACATGATTGAGCACCCACAGCGATCTA