Skip to main content

Advertisement

Table 1 qPCR Primers Used in the Present Study

From: Establishment of automated culture system for murine induced pluripotent stem cells

Gene Forward Primer Reverse Primer (UPL) probe
Oct3/4 GTTGGAGAAGGTGGAACCAA CTCCTTCTGCAGGGCTTTC #95
Sox2 TCCAAAAACTAATCACAACAATCG GAAGTGCAATTGGGATGAAAA #63
Klf4 CGGGAAGGGAGAAGACACT GAGTTCCTCACGCCAACG #62
c-Myc CCTAGTGCTGCATGAGGAGA TCTTCCTCATCTTCTTGCTCTTC #77
Nanog TTCTTGCTTACAAGGGTCTGC AGAGGAAGGGCGAGGAGA #110
Zfp42 TCTTCTCTCAATAGAGTGAGTGTGC GCTTTCTTCTGTGTGCAGGA #71
Ttr CCTGCAGCCGCATTAAGT GATGGTGTAGTGGCGATGG #76
Afp CATGCTGCAAAGCTGACAA CATGCTGCAAAGCTGACAA #63
Myh6 CGCATCAAGGAGCTCACC CCTGCAGCCGCATTAAGT #6
Brachyury CAGCCCACCTACTGGCTCTA GAGCCTGGGGTGATGGTA #100
Gfap TCGAGATCGCCACCTACAG GTCTGTACAGGAATGGTGATGC #67
Nes TCCCTTAGTCTGGAAGTGGCTA GGTGTCTGCAAGCGAGAGTT #67
CD13 AATCTCATCCAGGGAGTGACC TCCGCTTTAAACTGCTCCAG #82
Gapdh AGCTTGTCATCAACGGGAAG TTTGATGTTAGTGGGGTCTCG #9